\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0613340957:

Variant ID: vg0613340957 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 13340957
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAACAACGTCCTATCTATCTACAGGGAAATCTCACTCCCTCTTATCCTTATCTCCTCCTGTCCTCTCCCAGCTCTCTCTCTCTCTCTCTCTCTCTGTCTC[C/T]
ACTCTCGATCCCTCCTCCCTCCTCCCACCTCAGATCCGAGGCGGGGGCTCGCAGCGGCGGATCGAGGATCCAAGGTCGCGCAAGCTCTGCTGTCCACAAC

Reverse complement sequence

GTTGTGGACAGCAGAGCTTGCGCGACCTTGGATCCTCGATCCGCCGCTGCGAGCCCCCGCCTCGGATCTGAGGTGGGAGGAGGGAGGAGGGATCGAGAGT[G/A]
GAGACAGAGAGAGAGAGAGAGAGAGAGAGCTGGGAGAGGACAGGAGGAGATAAGGATAAGAGGGAGTGAGATTTCCCTGTAGATAGATAGGACGTTGTTC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.80% 33.20% 0.00% 0.00% NA
All Indica  2759 97.40% 2.60% 0.00% 0.00% NA
All Japonica  1512 9.60% 90.40% 0.00% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 97.50% 2.50% 0.00% 0.00% NA
Indica II  465 96.80% 3.20% 0.00% 0.00% NA
Indica III  913 99.10% 0.90% 0.00% 0.00% NA
Indica Intermediate  786 95.50% 4.50% 0.00% 0.00% NA
Temperate Japonica  767 3.80% 96.20% 0.00% 0.00% NA
Tropical Japonica  504 19.40% 80.60% 0.00% 0.00% NA
Japonica Intermediate  241 7.50% 92.50% 0.00% 0.00% NA
VI/Aromatic  96 13.50% 86.50% 0.00% 0.00% NA
Intermediate  90 53.30% 46.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0613340957 C -> T LOC_Os06g22870.1 upstream_gene_variant ; 4376.0bp to feature; MODIFIER silent_mutation Average:69.184; most accessible tissue: Zhenshan97 young leaf, score: 83.623 N N N N
vg0613340957 C -> T LOC_Os06g22870.2 upstream_gene_variant ; 4376.0bp to feature; MODIFIER silent_mutation Average:69.184; most accessible tissue: Zhenshan97 young leaf, score: 83.623 N N N N
vg0613340957 C -> T LOC_Os06g22860.1 downstream_gene_variant ; 3602.0bp to feature; MODIFIER silent_mutation Average:69.184; most accessible tissue: Zhenshan97 young leaf, score: 83.623 N N N N
vg0613340957 C -> T LOC_Os06g22860-LOC_Os06g22870 intergenic_region ; MODIFIER silent_mutation Average:69.184; most accessible tissue: Zhenshan97 young leaf, score: 83.623 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0613340957 1.54E-24 2.29E-96 mr1033 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613340957 5.07E-11 3.47E-16 mr1033 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613340957 5.56E-17 1.98E-53 mr1176 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613340957 2.57E-08 1.90E-11 mr1176 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613340957 NA 7.25E-07 mr1278 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613340957 3.03E-09 1.06E-77 mr1536 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613340957 2.48E-08 2.48E-08 mr1536 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613340957 NA 1.72E-07 mr1824 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613340957 6.31E-28 4.40E-131 mr1033_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613340957 2.86E-12 3.03E-20 mr1033_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613340957 1.08E-09 1.24E-102 mr1536_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613340957 2.29E-08 1.30E-09 mr1536_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613340957 NA 7.37E-07 mr1548_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251