\
| Variant ID: vg0613294536 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 13294536 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 117. )
TTTTTGTCTTGTTTTGAAGATAAATCGAGGATTCAACGAGATGACAAATCAGAAAATATGTCACTTCATTCATGTGGTTTTAATGAAATACCCCTCACTA[C/T]
AATACATTCACTAAAGCATCATTTAGTACGTTACCTTCCTATTAAAATACTACTTTAAAGAGCTTTAACAATTTTATAACCAAAACACTCCTACCTATAA
TTATAGGTAGGAGTGTTTTGGTTATAAAATTGTTAAAGCTCTTTAAAGTAGTATTTTAATAGGAAGGTAACGTACTAAATGATGCTTTAGTGAATGTATT[G/A]
TAGTGAGGGGTATTTCATTAAAACCACATGAATGAAGTGACATATTTTCTGATTTGTCATCTCGTTGAATCCTCGATTTATCTTCAAAACAAGACAAAAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 51.30% | 44.80% | 0.51% | 3.43% | NA |
| All Indica | 2759 | 78.60% | 20.80% | 0.40% | 0.18% | NA |
| All Japonica | 1512 | 4.30% | 90.80% | 0.20% | 4.70% | NA |
| Aus | 269 | 51.30% | 15.60% | 2.97% | 30.11% | NA |
| Indica I | 595 | 80.30% | 19.30% | 0.34% | 0.00% | NA |
| Indica II | 465 | 90.30% | 9.20% | 0.43% | 0.00% | NA |
| Indica III | 913 | 71.30% | 28.10% | 0.33% | 0.22% | NA |
| Indica Intermediate | 786 | 78.90% | 20.20% | 0.51% | 0.38% | NA |
| Temperate Japonica | 767 | 3.50% | 96.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 6.20% | 81.20% | 0.40% | 12.30% | NA |
| Japonica Intermediate | 241 | 2.90% | 92.90% | 0.41% | 3.73% | NA |
| VI/Aromatic | 96 | 13.50% | 85.40% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 43.30% | 50.00% | 1.11% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0613294536 | C -> T | LOC_Os06g22810.1 | upstream_gene_variant ; 2551.0bp to feature; MODIFIER | silent_mutation | Average:61.295; most accessible tissue: Zhenshan97 flower, score: 78.5 | N | N | N | N |
| vg0613294536 | C -> T | LOC_Os06g22800-LOC_Os06g22810 | intergenic_region ; MODIFIER | silent_mutation | Average:61.295; most accessible tissue: Zhenshan97 flower, score: 78.5 | N | N | N | N |
| vg0613294536 | C -> DEL | N | N | silent_mutation | Average:61.295; most accessible tissue: Zhenshan97 flower, score: 78.5 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0613294536 | 1.68E-09 | 4.32E-15 | mr1033 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613294536 | 6.24E-06 | NA | mr1087 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613294536 | NA | 2.91E-08 | mr1087 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613294536 | NA | 2.29E-06 | mr1090 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613294536 | 3.44E-06 | 1.25E-09 | mr1176 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613294536 | 1.03E-07 | 1.03E-07 | mr1536 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613294536 | NA | 2.02E-08 | mr1824 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613294536 | 1.04E-09 | 7.17E-19 | mr1033_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613294536 | 2.38E-07 | NA | mr1087_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613294536 | NA | 4.97E-11 | mr1087_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613294536 | NA | 6.05E-09 | mr1112_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613294536 | NA | 8.15E-11 | mr1216_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613294536 | 1.99E-06 | NA | mr1234_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613294536 | 9.98E-08 | 1.09E-09 | mr1536_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |