\
| Variant ID: vg0613223540 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 13223540 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
AGTGCCCTCGGCATCAATCCCATCCACTTGTGTTGTAGGCACGCCTTGATTGTCCTCTGCCCAGAACTTCCTGGCAGATGGACCCGGAACTTCCTGGCCT[G/A]
GGGAGGTCCGGAGGTTCCGATCATCTGGTCCCGGAACTTCCGGGTCAACTGACTCTTGACTTGTTGTAGGGCTATTGGATGTCGATGACGAAGGTTGATC
GATCAACCTTCGTCATCGACATCCAATAGCCCTACAACAAGTCAAGAGTCAGTTGACCCGGAAGTTCCGGGACCAGATGATCGGAACCTCCGGACCTCCC[C/T]
AGGCCAGGAAGTTCCGGGTCCATCTGCCAGGAAGTTCTGGGCAGAGGACAATCAAGGCGTGCCTACAACACAAGTGGATGGGATTGATGCCGAGGGCACT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 72.40% | 27.00% | 0.61% | 0.00% | NA |
| All Indica | 2759 | 98.20% | 1.60% | 0.14% | 0.00% | NA |
| All Japonica | 1512 | 19.20% | 79.40% | 1.39% | 0.00% | NA |
| Aus | 269 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.80% | 2.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 97.20% | 2.80% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 97.60% | 2.00% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 6.00% | 91.90% | 2.09% | 0.00% | NA |
| Tropical Japonica | 504 | 40.50% | 59.10% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 17.00% | 81.70% | 1.24% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 70.00% | 25.60% | 4.44% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0613223540 | G -> A | LOC_Os06g22730.1 | missense_variant ; p.Pro116Leu; MODERATE | nonsynonymous_codon ; P116L | Average:40.868; most accessible tissue: Zhenshan97 flag leaf, score: 60.074 | benign |
0.378 |
TOLERATED | 0.32 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0613223540 | 7.54E-07 | 7.54E-07 | mr1110 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613223540 | NA | 1.54E-12 | mr1667 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613223540 | 1.40E-08 | NA | mr1033_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613223540 | NA | 9.30E-06 | mr1068_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613223540 | NA | 1.09E-06 | mr1096_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613223540 | NA | 5.02E-15 | mr1133_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613223540 | NA | 5.30E-06 | mr1211_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |