\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0613153084:

Variant ID: vg0613153084 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 13153084
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.78, T: 0.23, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:


ATAATCATCGGCTTTAGTTATGGCCCAGTATTAGGTTATTAACAATTGTGGCACCTGTTCCACGAACTAATATCCTCATATGCTCTGAACGTAATGTTAA[C/T]
AGCAGCAAGAGGAGTTCTGGCATTCCCGAGGTATTTAAGGGGAACTGATCGTATGACACCACGTCATCTCGATCAGGGTTTAGAAATATACCATATAATT

Reverse complement sequence

AATTATATGGTATATTTCTAAACCCTGATCGAGATGACGTGGTGTCATACGATCAGTTCCCCTTAAATACCTCGGGAATGCCAGAACTCCTCTTGCTGCT[G/A]
TTAACATTACGTTCAGAGCATATGAGGATATTAGTTCGTGGAACAGGTGCCACAATTGTTAATAACCTAATACTGGGCCATAACTAAAGCCGATGATTAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.60% 34.20% 0.02% 0.21% NA
All Indica  2759 95.50% 4.30% 0.00% 0.11% NA
All Japonica  1512 9.80% 89.90% 0.00% 0.33% NA
Aus  269 62.50% 37.50% 0.00% 0.00% NA
Indica I  595 93.80% 6.20% 0.00% 0.00% NA
Indica II  465 95.90% 3.90% 0.00% 0.22% NA
Indica III  913 98.70% 1.10% 0.00% 0.22% NA
Indica Intermediate  786 93.00% 7.00% 0.00% 0.00% NA
Temperate Japonica  767 3.70% 96.30% 0.00% 0.00% NA
Tropical Japonica  504 19.60% 79.80% 0.00% 0.60% NA
Japonica Intermediate  241 8.70% 90.50% 0.00% 0.83% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 60.00% 36.70% 1.11% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0613153084 C -> T LOC_Os06g22610.1 downstream_gene_variant ; 4195.0bp to feature; MODIFIER silent_mutation Average:37.805; most accessible tissue: Minghui63 flag leaf, score: 59.912 N N N N
vg0613153084 C -> T LOC_Os06g22630.1 downstream_gene_variant ; 3234.0bp to feature; MODIFIER silent_mutation Average:37.805; most accessible tissue: Minghui63 flag leaf, score: 59.912 N N N N
vg0613153084 C -> T LOC_Os06g22620.1 intron_variant ; MODIFIER silent_mutation Average:37.805; most accessible tissue: Minghui63 flag leaf, score: 59.912 N N N N
vg0613153084 C -> DEL N N silent_mutation Average:37.805; most accessible tissue: Minghui63 flag leaf, score: 59.912 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0613153084 1.11E-12 1.98E-74 mr1033 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613153084 1.62E-08 7.75E-14 mr1033 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613153084 2.74E-11 3.17E-16 mr1033 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613153084 NA 1.64E-06 mr1082 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613153084 NA 2.59E-06 mr1086 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613153084 5.59E-06 3.84E-07 mr1100 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613153084 NA 2.81E-06 mr1103 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613153084 NA 2.49E-06 mr1140 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613153084 NA 3.40E-10 mr1175 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613153084 9.14E-09 4.16E-42 mr1176 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613153084 NA 3.74E-09 mr1176 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613153084 8.60E-08 1.32E-10 mr1176 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613153084 NA 1.13E-06 mr1203 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613153084 NA 4.42E-06 mr1204 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613153084 NA 8.05E-39 mr1235 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613153084 NA 1.13E-08 mr1301 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613153084 8.91E-06 1.39E-07 mr1395 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613153084 NA 2.99E-35 mr1402 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613153084 NA 6.03E-08 mr1410 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613153084 NA 3.34E-06 mr1436 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613153084 3.52E-08 3.52E-08 mr1536 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613153084 NA 6.29E-06 mr1618 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613153084 NA 5.36E-06 mr1619 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613153084 NA 1.71E-09 mr1637 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613153084 2.05E-10 NA mr1033_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613153084 NA 2.19E-14 mr1033_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613153084 1.67E-13 1.35E-21 mr1033_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613153084 NA 1.56E-07 mr1100_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613153084 NA 6.45E-07 mr1302_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613153084 4.78E-09 1.09E-10 mr1536_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613153084 NA 1.93E-08 mr1548_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613153084 NA 2.94E-07 mr1604_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613153084 NA 7.08E-14 mr1950_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251