\
| Variant ID: vg0613153084 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 13153084 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.78, T: 0.23, others allele: 0.00, population size: 254. )
ATAATCATCGGCTTTAGTTATGGCCCAGTATTAGGTTATTAACAATTGTGGCACCTGTTCCACGAACTAATATCCTCATATGCTCTGAACGTAATGTTAA[C/T]
AGCAGCAAGAGGAGTTCTGGCATTCCCGAGGTATTTAAGGGGAACTGATCGTATGACACCACGTCATCTCGATCAGGGTTTAGAAATATACCATATAATT
AATTATATGGTATATTTCTAAACCCTGATCGAGATGACGTGGTGTCATACGATCAGTTCCCCTTAAATACCTCGGGAATGCCAGAACTCCTCTTGCTGCT[G/A]
TTAACATTACGTTCAGAGCATATGAGGATATTAGTTCGTGGAACAGGTGCCACAATTGTTAATAACCTAATACTGGGCCATAACTAAAGCCGATGATTAT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 65.60% | 34.20% | 0.02% | 0.21% | NA |
| All Indica | 2759 | 95.50% | 4.30% | 0.00% | 0.11% | NA |
| All Japonica | 1512 | 9.80% | 89.90% | 0.00% | 0.33% | NA |
| Aus | 269 | 62.50% | 37.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 95.90% | 3.90% | 0.00% | 0.22% | NA |
| Indica III | 913 | 98.70% | 1.10% | 0.00% | 0.22% | NA |
| Indica Intermediate | 786 | 93.00% | 7.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 3.70% | 96.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 19.60% | 79.80% | 0.00% | 0.60% | NA |
| Japonica Intermediate | 241 | 8.70% | 90.50% | 0.00% | 0.83% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 60.00% | 36.70% | 1.11% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0613153084 | C -> T | LOC_Os06g22610.1 | downstream_gene_variant ; 4195.0bp to feature; MODIFIER | silent_mutation | Average:37.805; most accessible tissue: Minghui63 flag leaf, score: 59.912 | N | N | N | N |
| vg0613153084 | C -> T | LOC_Os06g22630.1 | downstream_gene_variant ; 3234.0bp to feature; MODIFIER | silent_mutation | Average:37.805; most accessible tissue: Minghui63 flag leaf, score: 59.912 | N | N | N | N |
| vg0613153084 | C -> T | LOC_Os06g22620.1 | intron_variant ; MODIFIER | silent_mutation | Average:37.805; most accessible tissue: Minghui63 flag leaf, score: 59.912 | N | N | N | N |
| vg0613153084 | C -> DEL | N | N | silent_mutation | Average:37.805; most accessible tissue: Minghui63 flag leaf, score: 59.912 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0613153084 | 1.11E-12 | 1.98E-74 | mr1033 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613153084 | 1.62E-08 | 7.75E-14 | mr1033 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613153084 | 2.74E-11 | 3.17E-16 | mr1033 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613153084 | NA | 1.64E-06 | mr1082 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613153084 | NA | 2.59E-06 | mr1086 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613153084 | 5.59E-06 | 3.84E-07 | mr1100 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613153084 | NA | 2.81E-06 | mr1103 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613153084 | NA | 2.49E-06 | mr1140 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613153084 | NA | 3.40E-10 | mr1175 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613153084 | 9.14E-09 | 4.16E-42 | mr1176 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613153084 | NA | 3.74E-09 | mr1176 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613153084 | 8.60E-08 | 1.32E-10 | mr1176 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613153084 | NA | 1.13E-06 | mr1203 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613153084 | NA | 4.42E-06 | mr1204 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613153084 | NA | 8.05E-39 | mr1235 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613153084 | NA | 1.13E-08 | mr1301 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613153084 | 8.91E-06 | 1.39E-07 | mr1395 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613153084 | NA | 2.99E-35 | mr1402 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613153084 | NA | 6.03E-08 | mr1410 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613153084 | NA | 3.34E-06 | mr1436 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613153084 | 3.52E-08 | 3.52E-08 | mr1536 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613153084 | NA | 6.29E-06 | mr1618 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613153084 | NA | 5.36E-06 | mr1619 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613153084 | NA | 1.71E-09 | mr1637 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613153084 | 2.05E-10 | NA | mr1033_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613153084 | NA | 2.19E-14 | mr1033_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613153084 | 1.67E-13 | 1.35E-21 | mr1033_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613153084 | NA | 1.56E-07 | mr1100_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613153084 | NA | 6.45E-07 | mr1302_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613153084 | 4.78E-09 | 1.09E-10 | mr1536_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613153084 | NA | 1.93E-08 | mr1548_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613153084 | NA | 2.94E-07 | mr1604_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613153084 | NA | 7.08E-14 | mr1950_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |