Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0613146169:

Variant ID: vg0613146169 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 13146169
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 263. )

Flanking Sequence (100 bp) in Reference Genome:


AATTTTGGTGTCCTATAATGATTGGAAAACATACCAAACGTCCAATATTCGTGTTAAACATAACCAAAGGGATGAGAACTAATCACTTGACCATGCAAAA[T/C]
GAAACGACTCATTAGCACACAATTAATTTAGTATTAGCTAAAATTTTGTATACCGGTGTTAAAAAAGGTGTAATCACCCGAAAATGGACTTAAAAACTAG

Reverse complement sequence

CTAGTTTTTAAGTCCATTTTCGGGTGATTACACCTTTTTTAACACCGGTATACAAAATTTTAGCTAATACTAAATTAATTGTGTGCTAATGAGTCGTTTC[A/G]
TTTTGCATGGTCAAGTGATTAGTTCTCATCCCTTTGGTTATGTTTAACACGAATATTGGACGTTTGGTATGTTTTCCAATCATTATAGGACACCAAAATT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.00% 30.70% 0.04% 0.23% NA
All Indica  2759 97.50% 2.30% 0.04% 0.14% NA
All Japonica  1512 9.80% 89.90% 0.00% 0.33% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 97.50% 2.20% 0.17% 0.17% NA
Indica II  465 96.60% 3.20% 0.00% 0.22% NA
Indica III  913 99.30% 0.40% 0.00% 0.22% NA
Indica Intermediate  786 95.90% 4.10% 0.00% 0.00% NA
Temperate Japonica  767 3.70% 96.30% 0.00% 0.00% NA
Tropical Japonica  504 19.60% 79.80% 0.00% 0.60% NA
Japonica Intermediate  241 8.70% 90.50% 0.00% 0.83% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 65.60% 31.10% 1.11% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0613146169 T -> C LOC_Os06g22610.1 upstream_gene_variant ; 2108.0bp to feature; MODIFIER silent_mutation Average:79.623; most accessible tissue: Zhenshan97 root, score: 84.5 N N N N
vg0613146169 T -> C LOC_Os06g22600.1 downstream_gene_variant ; 99.0bp to feature; MODIFIER silent_mutation Average:79.623; most accessible tissue: Zhenshan97 root, score: 84.5 N N N N
vg0613146169 T -> C LOC_Os06g22600-LOC_Os06g22610 intergenic_region ; MODIFIER silent_mutation Average:79.623; most accessible tissue: Zhenshan97 root, score: 84.5 N N N N
vg0613146169 T -> DEL N N silent_mutation Average:79.623; most accessible tissue: Zhenshan97 root, score: 84.5 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0613146169 NA 3.48E-74 mr1018 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613146169 NA 1.10E-57 mr1019 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613146169 NA 2.22E-21 mr1020 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613146169 8.97E-16 2.39E-82 mr1033 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613146169 2.74E-11 3.17E-16 mr1033 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613146169 NA 3.41E-20 mr1102 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613146169 NA 2.25E-35 mr1105 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613146169 NA 1.20E-71 mr1132 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613146169 NA 9.19E-12 mr1172 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613146169 4.13E-09 4.09E-43 mr1176 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613146169 8.60E-08 1.32E-10 mr1176 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613146169 NA 2.84E-58 mr1178 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613146169 NA 7.24E-30 mr1223 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613146169 NA 2.88E-07 mr1245 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613146169 NA 1.45E-16 mr1276 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613146169 NA 2.98E-52 mr1390 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613146169 NA 6.39E-21 mr1477 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613146169 NA 7.06E-19 mr1529 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613146169 3.30E-07 NA mr1536 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613146169 3.52E-08 3.52E-08 mr1536 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613146169 NA 1.70E-36 mr1719 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613146169 NA 2.12E-24 mr1731 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613146169 NA 6.71E-15 mr1950 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613146169 NA 8.81E-21 mr1971 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613146169 2.91E-24 2.76E-119 mr1033_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613146169 1.67E-13 1.35E-21 mr1033_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613146169 NA 5.69E-73 mr1178_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613146169 NA 1.38E-19 mr1276_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613146169 NA 1.29E-23 mr1403_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613146169 5.87E-11 5.08E-94 mr1536_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613146169 4.78E-09 1.09E-10 mr1536_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613146169 NA 1.26E-45 mr1546_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613146169 NA 6.36E-32 mr1780_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613146169 NA 2.62E-14 mr1950_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251