\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0613140822:

Variant ID: vg0613140822 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 13140822
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTGTTAGAGATAGTGGTCGTGTCCGGTATGGACATATCTTGTAATTCTCGGGTATAAATAGACCCCGAGCCCTATGTAATTTTTAACACACATTCAATAC[C/A]
ATTTCGGCGCATCGCCACCTTTTTGCTTTAGTTTTATTTCGACGAGTTCTTGCTTTCGGGTTGAGCTGCATCGGTTTCGATCTTCAACAAGAGGTAAAAC

Reverse complement sequence

GTTTTACCTCTTGTTGAAGATCGAAACCGATGCAGCTCAACCCGAAAGCAAGAACTCGTCGAAATAAAACTAAAGCAAAAAGGTGGCGATGCGCCGAAAT[G/T]
GTATTGAATGTGTGTTAAAAATTACATAGGGCTCGGGGTCTATTTATACCCGAGAATTACAAGATATGTCCATACCGGACACGACCACTATCTCTAACAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 31.90% 0.20% 18.58% 49.34% NA
All Indica  2759 3.60% 0.30% 18.74% 77.35% NA
All Japonica  1512 90.50% 0.00% 7.41% 2.12% NA
Aus  269 0.70% 0.00% 59.48% 39.78% NA
Indica I  595 4.20% 0.30% 14.45% 81.01% NA
Indica II  465 4.30% 0.20% 6.24% 89.25% NA
Indica III  913 1.50% 0.20% 29.35% 68.89% NA
Indica Intermediate  786 5.20% 0.40% 17.05% 77.35% NA
Temperate Japonica  767 96.60% 0.00% 0.13% 3.26% NA
Tropical Japonica  504 80.80% 0.00% 18.45% 0.79% NA
Japonica Intermediate  241 91.30% 0.00% 7.47% 1.24% NA
VI/Aromatic  96 3.10% 0.00% 70.83% 26.04% NA
Intermediate  90 38.90% 0.00% 23.33% 37.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0613140822 C -> A LOC_Os06g22590.1 upstream_gene_variant ; 707.0bp to feature; MODIFIER silent_mutation Average:26.904; most accessible tissue: Minghui63 panicle, score: 50.413 N N N N
vg0613140822 C -> A LOC_Os06g22600.1 upstream_gene_variant ; 2984.0bp to feature; MODIFIER silent_mutation Average:26.904; most accessible tissue: Minghui63 panicle, score: 50.413 N N N N
vg0613140822 C -> A LOC_Os06g22580.1 downstream_gene_variant ; 4492.0bp to feature; MODIFIER silent_mutation Average:26.904; most accessible tissue: Minghui63 panicle, score: 50.413 N N N N
vg0613140822 C -> A LOC_Os06g22590-LOC_Os06g22600 intergenic_region ; MODIFIER silent_mutation Average:26.904; most accessible tissue: Minghui63 panicle, score: 50.413 N N N N
vg0613140822 C -> DEL N N silent_mutation Average:26.904; most accessible tissue: Minghui63 panicle, score: 50.413 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0613140822 NA 6.72E-22 mr1020 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613140822 4.89E-17 2.37E-84 mr1033 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613140822 9.41E-15 2.44E-20 mr1033 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613140822 1.37E-09 4.26E-44 mr1176 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613140822 6.70E-10 3.45E-13 mr1176 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613140822 NA 1.61E-15 mr1276 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613140822 NA 4.93E-21 mr1477 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613140822 NA 1.31E-13 mr1478 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613140822 3.07E-06 NA mr1536 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613140822 3.09E-09 3.09E-09 mr1536 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613140822 NA 2.44E-21 mr1971 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613140822 2.29E-22 3.69E-118 mr1033_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613140822 2.79E-18 1.03E-27 mr1033_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613140822 NA 8.09E-20 mr1276_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613140822 9.06E-08 NA mr1536_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613140822 1.53E-10 3.70E-12 mr1536_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613140822 NA 2.19E-14 mr1950_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251