Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0613140822:

Variant ID: vg0613140822 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 13140822
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTGTTAGAGATAGTGGTCGTGTCCGGTATGGACATATCTTGTAATTCTCGGGTATAAATAGACCCCGAGCCCTATGTAATTTTTAACACACATTCAATAC[C/A]
ATTTCGGCGCATCGCCACCTTTTTGCTTTAGTTTTATTTCGACGAGTTCTTGCTTTCGGGTTGAGCTGCATCGGTTTCGATCTTCAACAAGAGGTAAAAC

Reverse complement sequence

GTTTTACCTCTTGTTGAAGATCGAAACCGATGCAGCTCAACCCGAAAGCAAGAACTCGTCGAAATAAAACTAAAGCAAAAAGGTGGCGATGCGCCGAAAT[G/T]
GTATTGAATGTGTGTTAAAAATTACATAGGGCTCGGGGTCTATTTATACCCGAGAATTACAAGATATGTCCATACCGGACACGACCACTATCTCTAACAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	31.90%	0.20%	18.58%	49.34%	NA
All Indica	2759	3.60%	0.30%	18.74%	77.35%	NA
All Japonica	1512	90.50%	0.00%	7.41%	2.12%	NA
Aus	269	0.70%	0.00%	59.48%	39.78%	NA
Indica I	595	4.20%	0.30%	14.45%	81.01%	NA
Indica II	465	4.30%	0.20%	6.24%	89.25%	NA
Indica III	913	1.50%	0.20%	29.35%	68.89%	NA
Indica Intermediate	786	5.20%	0.40%	17.05%	77.35%	NA
Temperate Japonica	767	96.60%	0.00%	0.13%	3.26%	NA
Tropical Japonica	504	80.80%	0.00%	18.45%	0.79%	NA
Japonica Intermediate	241	91.30%	0.00%	7.47%	1.24%	NA
VI/Aromatic	96	3.10%	0.00%	70.83%	26.04%	NA
Intermediate	90	38.90%	0.00%	23.33%	37.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0613140822	C -> A	LOC_Os06g22590.1	upstream_gene_variant ; 707.0bp to feature; MODIFIER	silent_mutation	Average:26.904; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N
vg0613140822	C -> A	LOC_Os06g22600.1	upstream_gene_variant ; 2984.0bp to feature; MODIFIER	silent_mutation	Average:26.904; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N
vg0613140822	C -> A	LOC_Os06g22580.1	downstream_gene_variant ; 4492.0bp to feature; MODIFIER	silent_mutation	Average:26.904; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N
vg0613140822	C -> A	LOC_Os06g22590-LOC_Os06g22600	intergenic_region ; MODIFIER	silent_mutation	Average:26.904; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N
vg0613140822	C -> DEL	N	N	silent_mutation	Average:26.904; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0613140822	NA	6.72E-22	mr1020	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613140822	4.89E-17	2.37E-84	mr1033	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613140822	9.41E-15	2.44E-20	mr1033	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613140822	1.37E-09	4.26E-44	mr1176	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613140822	6.70E-10	3.45E-13	mr1176	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613140822	NA	1.61E-15	mr1276	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613140822	NA	4.93E-21	mr1477	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613140822	NA	1.31E-13	mr1478	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613140822	3.07E-06	NA	mr1536	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613140822	3.09E-09	3.09E-09	mr1536	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613140822	NA	2.44E-21	mr1971	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613140822	2.29E-22	3.69E-118	mr1033_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613140822	2.79E-18	1.03E-27	mr1033_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613140822	NA	8.09E-20	mr1276_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613140822	9.06E-08	NA	mr1536_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613140822	1.53E-10	3.70E-12	mr1536_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613140822	NA	2.19E-14	mr1950_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251