Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0613133382:

Variant ID: vg0613133382 (JBrowse)	Variation Type: INDEL
Chromosome: chr06	Position: 13133382
Reference Allele: G	Alternative Allele: A,GTTA
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATGGAAGGCAGCCGATTAGGTTAAATAGCGACGTTGTCCTAGATTACATAAGATATCTACCACTTTATGAAACACCCAACGGCTTGATTGTCTAGATATT[G/A,GTTA]
TTCTTCTTTTCACACTTAATGCTGCATCAGTTGAGTTTGATCTATTAAGTCGTGCTTAGAATATCAATCTCTAGCCTGTCCTCTGGTTGCCGATTAGGGT

Reverse complement sequence

ACCCTAATCGGCAACCAGAGGACAGGCTAGAGATTGATATTCTAAGCACGACTTAATAGATCAAACTCAACTGATGCAGCATTAAGTGTGAAAAGAAGAA[C/T,TAAC]
AATATCTAGACAATCAAGCCGTTGGGTGTTTCATAAAGTGGTAGATATCTTATGTAATCTAGGACAACGTCGCTATTTAACCTAATCGGCTGCCTTCCAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.90%	6.90%	2.24%	0.00%	NA
All Indica	2759	99.00%	0.90%	0.11%	0.00%	NA
All Japonica	1512	80.40%	18.70%	0.93%	0.00%	NA
Aus	269	64.70%	4.10%	31.23%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	97.60%	2.40%	0.00%	0.00%	NA
Indica III	913	99.30%	0.30%	0.33%	0.00%	NA
Indica Intermediate	786	98.60%	1.40%	0.00%	0.00%	NA
Temperate Japonica	767	98.40%	1.60%	0.00%	0.00%	NA
Tropical Japonica	504	50.80%	46.80%	2.38%	0.00%	NA
Japonica Intermediate	241	85.10%	14.10%	0.83%	0.00%	NA
VI/Aromatic	96	97.90%	0.00%	2.08%	0.00%	NA
Intermediate	90	87.80%	8.90%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0613133382	G -> A	LOC_Os06g22580.1	upstream_gene_variant ; 1887.0bp to feature; MODIFIER	silent_mutation	Average:16.851; most accessible tissue: Minghui63 panicle, score: 25.313	N	N	N	N
vg0613133382	G -> A	LOC_Os06g22590.1	downstream_gene_variant ; 3535.0bp to feature; MODIFIER	silent_mutation	Average:16.851; most accessible tissue: Minghui63 panicle, score: 25.313	N	N	N	N
vg0613133382	G -> A	LOC_Os06g22560-LOC_Os06g22580	intergenic_region ; MODIFIER	silent_mutation	Average:16.851; most accessible tissue: Minghui63 panicle, score: 25.313	N	N	N	N
vg0613133382	G -> GTTA	LOC_Os06g22580.1	upstream_gene_variant ; 1886.0bp to feature; MODIFIER	N	Average:16.851; most accessible tissue: Minghui63 panicle, score: 25.313	N	N	N	N
vg0613133382	G -> GTTA	LOC_Os06g22590.1	downstream_gene_variant ; 3534.0bp to feature; MODIFIER	N	Average:16.851; most accessible tissue: Minghui63 panicle, score: 25.313	N	N	N	N
vg0613133382	G -> GTTA	LOC_Os06g22560-LOC_Os06g22580	intergenic_region ; MODIFIER	N	Average:16.851; most accessible tissue: Minghui63 panicle, score: 25.313	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0613133382	3.78E-07	1.83E-25	mr1301	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613133382	NA	1.20E-14	mr1410	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613133382	NA	4.51E-06	mr1518	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613133382	NA	3.49E-07	mr1993	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613133382	3.84E-06	7.25E-09	mr1084_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613133382	NA	1.03E-07	mr1205_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613133382	NA	1.44E-07	mr1206_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613133382	NA	2.45E-06	mr1206_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613133382	NA	3.33E-07	mr1229_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613133382	9.25E-06	5.21E-08	mr1236_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613133382	NA	1.59E-07	mr1263_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613133382	NA	3.58E-06	mr1419_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613133382	NA	2.09E-06	mr1420_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613133382	NA	8.37E-07	mr1488_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613133382	NA	2.46E-06	mr1596_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613133382	NA	5.75E-06	mr1786_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251