\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0613133382:

Variant ID: vg0613133382 (JBrowse)Variation Type: INDEL
Chromosome: chr06Position: 13133382
Reference Allele: GAlternative Allele: A,GTTA
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATGGAAGGCAGCCGATTAGGTTAAATAGCGACGTTGTCCTAGATTACATAAGATATCTACCACTTTATGAAACACCCAACGGCTTGATTGTCTAGATATT[G/A,GTTA]
TTCTTCTTTTCACACTTAATGCTGCATCAGTTGAGTTTGATCTATTAAGTCGTGCTTAGAATATCAATCTCTAGCCTGTCCTCTGGTTGCCGATTAGGGT

Reverse complement sequence

ACCCTAATCGGCAACCAGAGGACAGGCTAGAGATTGATATTCTAAGCACGACTTAATAGATCAAACTCAACTGATGCAGCATTAAGTGTGAAAAGAAGAA[C/T,TAAC]
AATATCTAGACAATCAAGCCGTTGGGTGTTTCATAAAGTGGTAGATATCTTATGTAATCTAGGACAACGTCGCTATTTAACCTAATCGGCTGCCTTCCAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.90% 6.90% 2.24% 0.00% NA
All Indica  2759 99.00% 0.90% 0.11% 0.00% NA
All Japonica  1512 80.40% 18.70% 0.93% 0.00% NA
Aus  269 64.70% 4.10% 31.23% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 97.60% 2.40% 0.00% 0.00% NA
Indica III  913 99.30% 0.30% 0.33% 0.00% NA
Indica Intermediate  786 98.60% 1.40% 0.00% 0.00% NA
Temperate Japonica  767 98.40% 1.60% 0.00% 0.00% NA
Tropical Japonica  504 50.80% 46.80% 2.38% 0.00% NA
Japonica Intermediate  241 85.10% 14.10% 0.83% 0.00% NA
VI/Aromatic  96 97.90% 0.00% 2.08% 0.00% NA
Intermediate  90 87.80% 8.90% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0613133382 G -> A LOC_Os06g22580.1 upstream_gene_variant ; 1887.0bp to feature; MODIFIER silent_mutation Average:16.851; most accessible tissue: Minghui63 panicle, score: 25.313 N N N N
vg0613133382 G -> A LOC_Os06g22590.1 downstream_gene_variant ; 3535.0bp to feature; MODIFIER silent_mutation Average:16.851; most accessible tissue: Minghui63 panicle, score: 25.313 N N N N
vg0613133382 G -> A LOC_Os06g22560-LOC_Os06g22580 intergenic_region ; MODIFIER silent_mutation Average:16.851; most accessible tissue: Minghui63 panicle, score: 25.313 N N N N
vg0613133382 G -> GTTA LOC_Os06g22580.1 upstream_gene_variant ; 1886.0bp to feature; MODIFIER N Average:16.851; most accessible tissue: Minghui63 panicle, score: 25.313 N N N N
vg0613133382 G -> GTTA LOC_Os06g22590.1 downstream_gene_variant ; 3534.0bp to feature; MODIFIER N Average:16.851; most accessible tissue: Minghui63 panicle, score: 25.313 N N N N
vg0613133382 G -> GTTA LOC_Os06g22560-LOC_Os06g22580 intergenic_region ; MODIFIER N Average:16.851; most accessible tissue: Minghui63 panicle, score: 25.313 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0613133382 3.78E-07 1.83E-25 mr1301 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613133382 NA 1.20E-14 mr1410 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613133382 NA 4.51E-06 mr1518 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613133382 NA 3.49E-07 mr1993 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613133382 3.84E-06 7.25E-09 mr1084_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613133382 NA 1.03E-07 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613133382 NA 1.44E-07 mr1206_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613133382 NA 2.45E-06 mr1206_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613133382 NA 3.33E-07 mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613133382 9.25E-06 5.21E-08 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613133382 NA 1.59E-07 mr1263_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613133382 NA 3.58E-06 mr1419_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613133382 NA 2.09E-06 mr1420_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613133382 NA 8.37E-07 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613133382 NA 2.46E-06 mr1596_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613133382 NA 5.75E-06 mr1786_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251