\
| Variant ID: vg0613092710 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 13092710 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CAACGGCTTGGAACGTTGCATGAGGAGGCCTTGCCGTCGCCTCCAGTCAGCCACTGCGCTTCTTCATCTTCTCGCTGTCGCGCTTCTCCATCTTTTGCCG[G/A]
ATCAAGGAGAGGTGGCGCCGTTGGCCGCTGCTGCAGCCAGTAGGCGGAAGGAGGCGCCGCTACTACAGGAAGGAGGTGCAAGGGCTGAGTATGGGAGGAT
ATCCTCCCATACTCAGCCCTTGCACCTCCTTCCTGTAGTAGCGGCGCCTCCTTCCGCCTACTGGCTGCAGCAGCGGCCAACGGCGCCACCTCTCCTTGAT[C/T]
CGGCAAAAGATGGAGAAGCGCGACAGCGAGAAGATGAAGAAGCGCAGTGGCTGACTGGAGGCGACGGCAAGGCCTCCTCATGCAACGTTCCAAGCCGTTG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.30% | 8.70% | 2.05% | 0.00% | NA |
| All Indica | 2759 | 84.00% | 13.40% | 2.57% | 0.00% | NA |
| All Japonica | 1512 | 99.10% | 0.70% | 0.13% | 0.00% | NA |
| Aus | 269 | 81.80% | 9.70% | 8.55% | 0.00% | NA |
| Indica I | 595 | 84.20% | 14.60% | 1.18% | 0.00% | NA |
| Indica II | 465 | 97.60% | 1.50% | 0.86% | 0.00% | NA |
| Indica III | 913 | 81.70% | 15.30% | 2.96% | 0.00% | NA |
| Indica Intermediate | 786 | 78.50% | 17.30% | 4.20% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 98.00% | 1.80% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.40% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 1.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0613092710 | G -> A | LOC_Os06g22520.1 | upstream_gene_variant ; 2475.0bp to feature; MODIFIER | silent_mutation | Average:53.182; most accessible tissue: Zhenshan97 flag leaf, score: 70.425 | N | N | N | N |
| vg0613092710 | G -> A | LOC_Os06g22530.1 | upstream_gene_variant ; 1562.0bp to feature; MODIFIER | silent_mutation | Average:53.182; most accessible tissue: Zhenshan97 flag leaf, score: 70.425 | N | N | N | N |
| vg0613092710 | G -> A | LOC_Os06g22540.1 | downstream_gene_variant ; 4952.0bp to feature; MODIFIER | silent_mutation | Average:53.182; most accessible tissue: Zhenshan97 flag leaf, score: 70.425 | N | N | N | N |
| vg0613092710 | G -> A | LOC_Os06g22520-LOC_Os06g22530 | intergenic_region ; MODIFIER | silent_mutation | Average:53.182; most accessible tissue: Zhenshan97 flag leaf, score: 70.425 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0613092710 | NA | 1.67E-15 | Plant_height | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0613092710 | NA | 5.34E-08 | mr1042 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613092710 | NA | 3.25E-06 | mr1042 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613092710 | NA | 1.96E-08 | mr1043 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613092710 | NA | 1.05E-06 | mr1043 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613092710 | NA | 5.89E-07 | mr1912 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613092710 | NA | 3.26E-06 | mr1043_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613092710 | NA | 4.36E-07 | mr1167_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613092710 | NA | 2.37E-06 | mr1180_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613092710 | NA | 2.76E-06 | mr1277_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |