\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0613092710:

Variant ID: vg0613092710 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 13092710
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAACGGCTTGGAACGTTGCATGAGGAGGCCTTGCCGTCGCCTCCAGTCAGCCACTGCGCTTCTTCATCTTCTCGCTGTCGCGCTTCTCCATCTTTTGCCG[G/A]
ATCAAGGAGAGGTGGCGCCGTTGGCCGCTGCTGCAGCCAGTAGGCGGAAGGAGGCGCCGCTACTACAGGAAGGAGGTGCAAGGGCTGAGTATGGGAGGAT

Reverse complement sequence

ATCCTCCCATACTCAGCCCTTGCACCTCCTTCCTGTAGTAGCGGCGCCTCCTTCCGCCTACTGGCTGCAGCAGCGGCCAACGGCGCCACCTCTCCTTGAT[C/T]
CGGCAAAAGATGGAGAAGCGCGACAGCGAGAAGATGAAGAAGCGCAGTGGCTGACTGGAGGCGACGGCAAGGCCTCCTCATGCAACGTTCCAAGCCGTTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.30% 8.70% 2.05% 0.00% NA
All Indica  2759 84.00% 13.40% 2.57% 0.00% NA
All Japonica  1512 99.10% 0.70% 0.13% 0.00% NA
Aus  269 81.80% 9.70% 8.55% 0.00% NA
Indica I  595 84.20% 14.60% 1.18% 0.00% NA
Indica II  465 97.60% 1.50% 0.86% 0.00% NA
Indica III  913 81.70% 15.30% 2.96% 0.00% NA
Indica Intermediate  786 78.50% 17.30% 4.20% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 98.00% 1.80% 0.20% 0.00% NA
Japonica Intermediate  241 99.20% 0.40% 0.41% 0.00% NA
VI/Aromatic  96 97.90% 1.00% 1.04% 0.00% NA
Intermediate  90 97.80% 2.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0613092710 G -> A LOC_Os06g22520.1 upstream_gene_variant ; 2475.0bp to feature; MODIFIER silent_mutation Average:53.182; most accessible tissue: Zhenshan97 flag leaf, score: 70.425 N N N N
vg0613092710 G -> A LOC_Os06g22530.1 upstream_gene_variant ; 1562.0bp to feature; MODIFIER silent_mutation Average:53.182; most accessible tissue: Zhenshan97 flag leaf, score: 70.425 N N N N
vg0613092710 G -> A LOC_Os06g22540.1 downstream_gene_variant ; 4952.0bp to feature; MODIFIER silent_mutation Average:53.182; most accessible tissue: Zhenshan97 flag leaf, score: 70.425 N N N N
vg0613092710 G -> A LOC_Os06g22520-LOC_Os06g22530 intergenic_region ; MODIFIER silent_mutation Average:53.182; most accessible tissue: Zhenshan97 flag leaf, score: 70.425 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0613092710 NA 1.67E-15 Plant_height Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0613092710 NA 5.34E-08 mr1042 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613092710 NA 3.25E-06 mr1042 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613092710 NA 1.96E-08 mr1043 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613092710 NA 1.05E-06 mr1043 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613092710 NA 5.89E-07 mr1912 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613092710 NA 3.26E-06 mr1043_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613092710 NA 4.36E-07 mr1167_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613092710 NA 2.37E-06 mr1180_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613092710 NA 2.76E-06 mr1277_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251