Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0613092710:

Variant ID: vg0613092710 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 13092710
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CAACGGCTTGGAACGTTGCATGAGGAGGCCTTGCCGTCGCCTCCAGTCAGCCACTGCGCTTCTTCATCTTCTCGCTGTCGCGCTTCTCCATCTTTTGCCG[G/A]
ATCAAGGAGAGGTGGCGCCGTTGGCCGCTGCTGCAGCCAGTAGGCGGAAGGAGGCGCCGCTACTACAGGAAGGAGGTGCAAGGGCTGAGTATGGGAGGAT

Reverse complement sequence

ATCCTCCCATACTCAGCCCTTGCACCTCCTTCCTGTAGTAGCGGCGCCTCCTTCCGCCTACTGGCTGCAGCAGCGGCCAACGGCGCCACCTCTCCTTGAT[C/T]
CGGCAAAAGATGGAGAAGCGCGACAGCGAGAAGATGAAGAAGCGCAGTGGCTGACTGGAGGCGACGGCAAGGCCTCCTCATGCAACGTTCCAAGCCGTTG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.30%	8.70%	2.05%	0.00%	NA
All Indica	2759	84.00%	13.40%	2.57%	0.00%	NA
All Japonica	1512	99.10%	0.70%	0.13%	0.00%	NA
Aus	269	81.80%	9.70%	8.55%	0.00%	NA
Indica I	595	84.20%	14.60%	1.18%	0.00%	NA
Indica II	465	97.60%	1.50%	0.86%	0.00%	NA
Indica III	913	81.70%	15.30%	2.96%	0.00%	NA
Indica Intermediate	786	78.50%	17.30%	4.20%	0.00%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	98.00%	1.80%	0.20%	0.00%	NA
Japonica Intermediate	241	99.20%	0.40%	0.41%	0.00%	NA
VI/Aromatic	96	97.90%	1.00%	1.04%	0.00%	NA
Intermediate	90	97.80%	2.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0613092710	G -> A	LOC_Os06g22520.1	upstream_gene_variant ; 2475.0bp to feature; MODIFIER	silent_mutation	Average:53.182; most accessible tissue: Zhenshan97 flag leaf, score: 70.425	N	N	N	N
vg0613092710	G -> A	LOC_Os06g22530.1	upstream_gene_variant ; 1562.0bp to feature; MODIFIER	silent_mutation	Average:53.182; most accessible tissue: Zhenshan97 flag leaf, score: 70.425	N	N	N	N
vg0613092710	G -> A	LOC_Os06g22540.1	downstream_gene_variant ; 4952.0bp to feature; MODIFIER	silent_mutation	Average:53.182; most accessible tissue: Zhenshan97 flag leaf, score: 70.425	N	N	N	N
vg0613092710	G -> A	LOC_Os06g22520-LOC_Os06g22530	intergenic_region ; MODIFIER	silent_mutation	Average:53.182; most accessible tissue: Zhenshan97 flag leaf, score: 70.425	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0613092710	NA	1.67E-15	Plant_height	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0613092710	NA	5.34E-08	mr1042	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613092710	NA	3.25E-06	mr1042	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613092710	NA	1.96E-08	mr1043	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613092710	NA	1.05E-06	mr1043	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613092710	NA	5.89E-07	mr1912	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613092710	NA	3.26E-06	mr1043_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613092710	NA	4.36E-07	mr1167_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613092710	NA	2.37E-06	mr1180_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613092710	NA	2.76E-06	mr1277_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251