\
| Variant ID: vg0613088823 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 13088823 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 272. )
CCATCTTGTCCCGAAAATTTGGAGAAGTCCGGGACTTTGAACCGATTGGGAAGAGGAACTCTCTCAAACCACTCAGGGTAAGGCTGCCGATACAAGCTTC[C/T]
AGTCTCTTTTGGTTTAAGCCCAAACTGTTCCCTCATTACGTCGGCAATCACATCGGCCCATGGTCGCTGCTGAGCTGCTGCTTGTGGCTGTTGCTGCATG
CATGCAGCAACAGCCACAAGCAGCAGCTCAGCAGCGACCATGGGCCGATGTGATTGCCGACGTAATGAGGGAACAGTTTGGGCTTAAACCAAAAGAGACT[G/A]
GAAGCTTGTATCGGCAGCCTTACCCTGAGTGGTTTGAGAGAGTTCCTCTTCCCAATCGGTTCAAAGTCCCGGACTTCTCCAAATTTTCGGGACAAGATGG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.60% | 9.30% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 85.70% | 14.30% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 99.10% | 0.90% | 0.07% | 0.00% | NA |
| Aus | 269 | 88.80% | 10.80% | 0.37% | 0.00% | NA |
| Indica I | 595 | 87.10% | 12.80% | 0.17% | 0.00% | NA |
| Indica II | 465 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Indica III | 913 | 80.60% | 19.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 82.80% | 17.20% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.40% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0613088823 | C -> T | LOC_Os06g22520.1 | missense_variant ; p.Gly391Arg; MODERATE | nonsynonymous_codon ; G391R | Average:47.756; most accessible tissue: Zhenshan97 flag leaf, score: 68.25 | benign |
0.92 |
DELETERIOUS | 0.04 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0613088823 | NA | 1.58E-06 | mr1042 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613088823 | NA | 7.09E-07 | mr1043 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613088823 | NA | 3.64E-06 | mr1043 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613088823 | NA | 6.15E-07 | mr1912 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613088823 | NA | 5.47E-06 | mr1912 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613088823 | NA | 9.68E-07 | mr1043_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613088823 | NA | 3.61E-06 | mr1291_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613088823 | NA | 4.68E-06 | mr1291_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613088823 | NA | 1.49E-06 | mr1677_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613088823 | 3.60E-06 | NA | mr1860_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613088823 | NA | 3.99E-06 | mr1860_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |