\
| Variant ID: vg0613084325 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 13084325 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
CTCTGAACGGCCATGGCTTAATAATAGGATTCATAGCCAACGTCGGCGCTCGCTGAATTGCTCCAAACTTTTGACAATCTTGACACCCCCTATAATATCT[G/A]
AAACAATCCTCCAGCATTGTCGGCCAAAAGTACCCTGCACGCAGAAGCAACCACTTCATCTTATGAGCCGATTGATGAGTACCACAGATTCCTTCATGAA
TTCATGAAGGAATCTGTGGTACTCATCAATCGGCTCATAAGATGAAGTGGTTGCTTCTGCGTGCAGGGTACTTTTGGCCGACAATGCTGGAGGATTGTTT[C/T]
AGATATTATAGGGGGTGTCAAGATTGTCAAAAGTTTGGAGCAATTCAGCGAGCGCCGACGTTGGCTATGAATCCTATTATTAAGCCATGGCCGTTCAGAG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 59.70% | 38.70% | 1.42% | 0.19% | NA |
| All Indica | 2759 | 93.40% | 3.90% | 2.36% | 0.33% | NA |
| All Japonica | 1512 | 3.00% | 97.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 57.60% | 42.00% | 0.37% | 0.00% | NA |
| Indica I | 595 | 90.60% | 3.70% | 4.54% | 1.18% | NA |
| Indica II | 465 | 92.00% | 4.90% | 2.80% | 0.22% | NA |
| Indica III | 913 | 98.20% | 1.60% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 90.80% | 6.00% | 3.05% | 0.13% | NA |
| Temperate Japonica | 767 | 3.50% | 96.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 3.00% | 97.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 1.70% | 98.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 3.10% | 96.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 44.40% | 54.40% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0613084325 | G -> A | LOC_Os06g22520.1 | synonymous_variant ; p.Phe1505Phe; LOW | synonymous_codon | Average:32.021; most accessible tissue: Minghui63 young leaf, score: 43.347 | N | N | N | N |
| vg0613084325 | G -> DEL | LOC_Os06g22520.1 | N | frameshift_variant | Average:32.021; most accessible tissue: Minghui63 young leaf, score: 43.347 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0613084325 | NA | 7.61E-10 | mr1033 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613084325 | NA | 7.46E-26 | mr1076 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613084325 | NA | 1.90E-07 | mr1076 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613084325 | NA | 1.22E-38 | mr1082 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613084325 | NA | 1.59E-06 | mr1082 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613084325 | NA | 1.43E-06 | mr1085 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613084325 | NA | 3.74E-06 | mr1103 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613084325 | NA | 9.63E-07 | mr1176 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613084325 | NA | 5.11E-06 | mr1204 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613084325 | NA | 4.99E-42 | mr1534 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613084325 | NA | 5.98E-08 | mr1560 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613084325 | NA | 6.37E-07 | mr1620 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613084325 | NA | 1.88E-13 | mr1713 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613084325 | 7.90E-07 | 4.20E-69 | mr1865 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |