\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0613062563:

Variant ID: vg0613062563 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 13062563
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.70, T: 0.30, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:


GAATCAAACATGTTCCAGAAGCCCATCTAATACGCAAGTTATAGGTGGTATTATTTTCATGGAAAAAGTACGAATTACCTCCTGAACTATCGTGGTCGAT[T/C]
GAATTACTACTTGTTAATAACGGGATTTGGTATTAGATTCGGAAAAGAAGGAAGAAAATTGAAGCGGATTTGGTGTTAAATCGAATTGAATTTGGAGTCG

Reverse complement sequence

CGACTCCAAATTCAATTCGATTTAACACCAAATCCGCTTCAATTTTCTTCCTTCTTTTCCGAATCTAATACCAAATCCCGTTATTAACAAGTAGTAATTC[A/G]
ATCGACCACGATAGTTCAGGAGGTAATTCGTACTTTTTCCATGAAAATAATACCACCTATAACTTGCGTATTAGATGGGCTTCTGGAACATGTTTGATTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.30% 39.50% 0.08% 0.11% NA
All Indica  2759 89.30% 10.40% 0.11% 0.14% NA
All Japonica  1512 4.80% 95.20% 0.00% 0.07% NA
Aus  269 85.50% 14.50% 0.00% 0.00% NA
Indica I  595 91.30% 8.40% 0.17% 0.17% NA
Indica II  465 94.80% 4.90% 0.22% 0.00% NA
Indica III  913 86.20% 13.70% 0.00% 0.11% NA
Indica Intermediate  786 88.20% 11.50% 0.13% 0.25% NA
Temperate Japonica  767 7.20% 92.70% 0.00% 0.13% NA
Tropical Japonica  504 1.40% 98.60% 0.00% 0.00% NA
Japonica Intermediate  241 4.10% 95.90% 0.00% 0.00% NA
VI/Aromatic  96 39.60% 60.40% 0.00% 0.00% NA
Intermediate  90 53.30% 45.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0613062563 T -> C LOC_Os06g22460.1 upstream_gene_variant ; 4536.0bp to feature; MODIFIER silent_mutation Average:42.931; most accessible tissue: Zhenshan97 young leaf, score: 63.653 N N N N
vg0613062563 T -> C LOC_Os06g22470.1 upstream_gene_variant ; 357.0bp to feature; MODIFIER silent_mutation Average:42.931; most accessible tissue: Zhenshan97 young leaf, score: 63.653 N N N N
vg0613062563 T -> C LOC_Os06g22480.1 upstream_gene_variant ; 1455.0bp to feature; MODIFIER silent_mutation Average:42.931; most accessible tissue: Zhenshan97 young leaf, score: 63.653 N N N N
vg0613062563 T -> C LOC_Os06g22470-LOC_Os06g22480 intergenic_region ; MODIFIER silent_mutation Average:42.931; most accessible tissue: Zhenshan97 young leaf, score: 63.653 N N N N
vg0613062563 T -> DEL N N silent_mutation Average:42.931; most accessible tissue: Zhenshan97 young leaf, score: 63.653 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0613062563 NA 4.74E-09 mr1033 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613062563 NA 4.32E-10 mr1065 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613062563 NA 3.03E-09 mr1067 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613062563 1.97E-07 1.13E-11 mr1068 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613062563 NA 9.61E-27 mr1072 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613062563 NA 1.01E-30 mr1075 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613062563 NA 7.90E-06 mr1075 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613062563 4.64E-06 NA mr1078 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613062563 3.41E-07 3.24E-10 mr1078 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613062563 NA 3.62E-09 mr1087 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613062563 4.73E-07 8.98E-08 mr1090 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613062563 1.64E-06 1.98E-07 mr1094 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613062563 2.97E-06 NA mr1096 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613062563 7.93E-07 3.23E-08 mr1096 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613062563 NA 7.54E-06 mr1107 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613062563 1.15E-06 NA mr1108 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613062563 1.17E-06 1.70E-13 mr1108 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613062563 NA 7.41E-09 mr1110 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613062563 2.09E-06 NA mr1111 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613062563 1.09E-06 1.82E-09 mr1111 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613062563 3.23E-06 NA mr1112 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613062563 3.82E-06 3.71E-10 mr1112 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613062563 2.51E-06 NA mr1121 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613062563 9.79E-08 1.31E-08 mr1121 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613062563 2.88E-06 NA mr1144 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613062563 7.80E-06 1.32E-08 mr1144 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613062563 NA 6.53E-23 mr1155 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613062563 NA 8.79E-07 mr1155 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613062563 8.78E-07 NA mr1200 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613062563 8.21E-06 5.90E-08 mr1200 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613062563 NA 3.79E-30 mr1202 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613062563 7.82E-06 3.34E-07 mr1211 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613062563 7.46E-06 NA mr1234 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613062563 NA 4.84E-09 mr1234 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613062563 NA 1.24E-08 mr1237 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613062563 NA 2.43E-36 mr1402 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613062563 NA 2.81E-06 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613062563 3.24E-06 NA mr1526 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613062563 NA 4.96E-10 mr1526 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613062563 NA 2.56E-08 mr1595 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613062563 NA 2.51E-23 mr1888 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613062563 NA 2.97E-12 mr1065_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613062563 NA 5.41E-11 mr1068_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613062563 NA 7.10E-09 mr1078_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613062563 NA 1.82E-69 mr1087_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613062563 NA 6.56E-12 mr1087_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613062563 NA 8.23E-07 mr1090_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613062563 NA 7.25E-07 mr1094_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613062563 5.94E-06 NA mr1096_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613062563 NA 1.02E-07 mr1096_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613062563 3.78E-07 NA mr1108_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613062563 NA 3.61E-12 mr1108_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613062563 4.79E-06 NA mr1111_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613062563 NA 3.61E-10 mr1111_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613062563 NA 5.00E-11 mr1112_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613062563 NA 1.31E-06 mr1121_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613062563 3.27E-06 NA mr1144_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613062563 NA 1.68E-08 mr1144_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613062563 NA 8.38E-09 mr1200_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613062563 NA 5.24E-08 mr1211_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613062563 NA 1.14E-08 mr1222_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613062563 NA 5.85E-13 mr1234_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613062563 NA 6.53E-11 mr1526_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251