\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0613051683:

Variant ID: vg0613051683 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 13051683
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAATCTTCCAGCAATCAACTACAACAAGAAGGAAGGGCCTACGCGTCGGACGACCGATGCTTCTGGGAAAAATCAGACGTTGACGTTAGCATGACGTCGG[C/T]
ACCCGATTTACGTGCAAAACTACTTTTAAACTAATTTTTCTTTTAAATTACTTATCCAAATCATGATCCGATTATACCATTAAATTCGTTGCAATTAAAC

Reverse complement sequence

GTTTAATTGCAACGAATTTAATGGTATAATCGGATCATGATTTGGATAAGTAATTTAAAAGAAAAATTAGTTTAAAAGTAGTTTTGCACGTAAATCGGGT[G/A]
CCGACGTCATGCTAACGTCAACGTCTGATTTTTCCCAGAAGCATCGGTCGTCCGACGCGTAGGCCCTTCCTTCTTGTTGTAGTTGATTGCTGGAAGATTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.30% 9.50% 0.19% 0.00% NA
All Indica  2759 92.10% 7.90% 0.04% 0.00% NA
All Japonica  1512 90.10% 9.50% 0.46% 0.00% NA
Aus  269 70.60% 29.00% 0.37% 0.00% NA
Indica I  595 94.10% 5.70% 0.17% 0.00% NA
Indica II  465 97.20% 2.80% 0.00% 0.00% NA
Indica III  913 87.50% 12.50% 0.00% 0.00% NA
Indica Intermediate  786 92.70% 7.30% 0.00% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 77.20% 22.80% 0.00% 0.00% NA
Japonica Intermediate  241 85.90% 11.20% 2.90% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 91.10% 8.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0613051683 C -> T LOC_Os06g22450.1 upstream_gene_variant ; 1086.0bp to feature; MODIFIER silent_mutation Average:41.594; most accessible tissue: Callus, score: 58.261 N N N N
vg0613051683 C -> T LOC_Os06g22460.1 downstream_gene_variant ; 3479.0bp to feature; MODIFIER silent_mutation Average:41.594; most accessible tissue: Callus, score: 58.261 N N N N
vg0613051683 C -> T LOC_Os06g22440-LOC_Os06g22450 intergenic_region ; MODIFIER silent_mutation Average:41.594; most accessible tissue: Callus, score: 58.261 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0613051683 NA 1.94E-06 mr1066 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613051683 NA 5.77E-09 mr1068 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613051683 NA 7.78E-09 mr1078 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613051683 NA 1.47E-06 mr1094 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613051683 NA 9.99E-07 mr1096 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613051683 NA 1.57E-06 mr1121 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613051683 NA 1.12E-06 mr1144 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613051683 NA 1.39E-06 mr1200 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613051683 NA 2.26E-06 mr1427 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613051683 NA 4.22E-07 mr1526 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613051683 NA 5.91E-08 mr1574 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613051683 NA 4.17E-06 mr1773 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613051683 9.08E-06 9.07E-06 mr1953 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613051683 NA 9.61E-09 mr1068_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613051683 NA 4.88E-08 mr1078_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613051683 NA 7.71E-07 mr1096_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613051683 NA 1.77E-07 mr1111_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613051683 NA 6.90E-06 mr1121_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613051683 NA 3.72E-07 mr1211_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251