Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0613051683:

Variant ID: vg0613051683 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 13051683
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GAATCTTCCAGCAATCAACTACAACAAGAAGGAAGGGCCTACGCGTCGGACGACCGATGCTTCTGGGAAAAATCAGACGTTGACGTTAGCATGACGTCGG[C/T]
ACCCGATTTACGTGCAAAACTACTTTTAAACTAATTTTTCTTTTAAATTACTTATCCAAATCATGATCCGATTATACCATTAAATTCGTTGCAATTAAAC

Reverse complement sequence

GTTTAATTGCAACGAATTTAATGGTATAATCGGATCATGATTTGGATAAGTAATTTAAAAGAAAAATTAGTTTAAAAGTAGTTTTGCACGTAAATCGGGT[G/A]
CCGACGTCATGCTAACGTCAACGTCTGATTTTTCCCAGAAGCATCGGTCGTCCGACGCGTAGGCCCTTCCTTCTTGTTGTAGTTGATTGCTGGAAGATTC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.30%	9.50%	0.19%	0.00%	NA
All Indica	2759	92.10%	7.90%	0.04%	0.00%	NA
All Japonica	1512	90.10%	9.50%	0.46%	0.00%	NA
Aus	269	70.60%	29.00%	0.37%	0.00%	NA
Indica I	595	94.10%	5.70%	0.17%	0.00%	NA
Indica II	465	97.20%	2.80%	0.00%	0.00%	NA
Indica III	913	87.50%	12.50%	0.00%	0.00%	NA
Indica Intermediate	786	92.70%	7.30%	0.00%	0.00%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	77.20%	22.80%	0.00%	0.00%	NA
Japonica Intermediate	241	85.90%	11.20%	2.90%	0.00%	NA
VI/Aromatic	96	95.80%	4.20%	0.00%	0.00%	NA
Intermediate	90	91.10%	8.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0613051683	C -> T	LOC_Os06g22450.1	upstream_gene_variant ; 1086.0bp to feature; MODIFIER	silent_mutation	Average:41.594; most accessible tissue: Callus, score: 58.261	N	N	N	N
vg0613051683	C -> T	LOC_Os06g22460.1	downstream_gene_variant ; 3479.0bp to feature; MODIFIER	silent_mutation	Average:41.594; most accessible tissue: Callus, score: 58.261	N	N	N	N
vg0613051683	C -> T	LOC_Os06g22440-LOC_Os06g22450	intergenic_region ; MODIFIER	silent_mutation	Average:41.594; most accessible tissue: Callus, score: 58.261	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0613051683	NA	1.94E-06	mr1066	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613051683	NA	5.77E-09	mr1068	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613051683	NA	7.78E-09	mr1078	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613051683	NA	1.47E-06	mr1094	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613051683	NA	9.99E-07	mr1096	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613051683	NA	1.57E-06	mr1121	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613051683	NA	1.12E-06	mr1144	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613051683	NA	1.39E-06	mr1200	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613051683	NA	2.26E-06	mr1427	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613051683	NA	4.22E-07	mr1526	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613051683	NA	5.91E-08	mr1574	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613051683	NA	4.17E-06	mr1773	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613051683	9.08E-06	9.07E-06	mr1953	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613051683	NA	9.61E-09	mr1068_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613051683	NA	4.88E-08	mr1078_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613051683	NA	7.71E-07	mr1096_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613051683	NA	1.77E-07	mr1111_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613051683	NA	6.90E-06	mr1121_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613051683	NA	3.72E-07	mr1211_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251