Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0613050715:

Variant ID: vg0613050715 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 13050715
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 272. )

Flanking Sequence (100 bp) in Reference Genome:

ATTTGTAAAAAAAAAAATGGCCAGTTGCACGATGAAACCATGGGCCCAAATTTTCCACTCCAGTTGCATGCACTTGAACTGTTGGCTGTTCTATACTAAA[C/T]
GAAACCATGGTTCATTGTAATTTATCTCTCGATCAATACAATTTCGGCGCATCGCTACCATTTTTACTTTTCTACTTTTCTCGACGAGTTCCTTCTTCAA

Reverse complement sequence

TTGAAGAAGGAACTCGTCGAGAAAAGTAGAAAAGTAAAAATGGTAGCGATGCGCCGAAATTGTATTGATCGAGAGATAAATTACAATGAACCATGGTTTC[G/A]
TTTAGTATAGAACAGCCAACAGTTCAAGTGCATGCAACTGGAGTGGAAAATTTGGGCCCATGGTTTCATCGTGCAACTGGCCATTTTTTTTTTTACAAAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	94.40%	4.80%	0.87%	0.00%	NA
All Indica	2759	91.00%	7.60%	1.38%	0.00%	NA
All Japonica	1512	99.10%	0.70%	0.13%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	98.00%	0.00%	2.02%	0.00%	NA
Indica II	465	89.50%	8.60%	1.94%	0.00%	NA
Indica III	913	86.90%	12.60%	0.55%	0.00%	NA
Indica Intermediate	786	91.60%	6.90%	1.53%	0.00%	NA
Temperate Japonica	767	98.40%	1.30%	0.26%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	93.30%	5.60%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0613050715	C -> T	LOC_Os06g22450.1	upstream_gene_variant ; 2054.0bp to feature; MODIFIER	silent_mutation	Average:47.967; most accessible tissue: Minghui63 panicle, score: 64.459	N	N	N	N
vg0613050715	C -> T	LOC_Os06g22460.1	downstream_gene_variant ; 4447.0bp to feature; MODIFIER	silent_mutation	Average:47.967; most accessible tissue: Minghui63 panicle, score: 64.459	N	N	N	N
vg0613050715	C -> T	LOC_Os06g22440-LOC_Os06g22450	intergenic_region ; MODIFIER	silent_mutation	Average:47.967; most accessible tissue: Minghui63 panicle, score: 64.459	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0613050715	2.04E-07	NA	mr1068	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613050715	7.15E-09	1.05E-12	mr1090	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613050715	4.54E-07	5.08E-07	mr1111	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613050715	2.14E-07	1.20E-09	mr1121	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613050715	NA	1.47E-07	mr1122	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613050715	2.10E-07	NA	mr1144	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613050715	1.49E-09	1.20E-13	mr1211	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613050715	2.70E-09	NA	mr1068_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613050715	6.21E-12	1.42E-12	mr1090_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613050715	9.84E-07	NA	mr1094_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613050715	1.02E-06	NA	mr1096_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613050715	6.57E-09	NA	mr1111_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613050715	5.90E-10	3.89E-11	mr1121_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613050715	3.56E-09	NA	mr1144_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613050715	4.24E-07	NA	mr1200_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613050715	3.17E-12	3.36E-15	mr1211_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613050715	NA	3.16E-07	mr1632_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251