\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0613050715:

Variant ID: vg0613050715 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 13050715
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 272. )

Flanking Sequence (100 bp) in Reference Genome:


ATTTGTAAAAAAAAAAATGGCCAGTTGCACGATGAAACCATGGGCCCAAATTTTCCACTCCAGTTGCATGCACTTGAACTGTTGGCTGTTCTATACTAAA[C/T]
GAAACCATGGTTCATTGTAATTTATCTCTCGATCAATACAATTTCGGCGCATCGCTACCATTTTTACTTTTCTACTTTTCTCGACGAGTTCCTTCTTCAA

Reverse complement sequence

TTGAAGAAGGAACTCGTCGAGAAAAGTAGAAAAGTAAAAATGGTAGCGATGCGCCGAAATTGTATTGATCGAGAGATAAATTACAATGAACCATGGTTTC[G/A]
TTTAGTATAGAACAGCCAACAGTTCAAGTGCATGCAACTGGAGTGGAAAATTTGGGCCCATGGTTTCATCGTGCAACTGGCCATTTTTTTTTTTACAAAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.40% 4.80% 0.87% 0.00% NA
All Indica  2759 91.00% 7.60% 1.38% 0.00% NA
All Japonica  1512 99.10% 0.70% 0.13% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.00% 0.00% 2.02% 0.00% NA
Indica II  465 89.50% 8.60% 1.94% 0.00% NA
Indica III  913 86.90% 12.60% 0.55% 0.00% NA
Indica Intermediate  786 91.60% 6.90% 1.53% 0.00% NA
Temperate Japonica  767 98.40% 1.30% 0.26% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 93.30% 5.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0613050715 C -> T LOC_Os06g22450.1 upstream_gene_variant ; 2054.0bp to feature; MODIFIER silent_mutation Average:47.967; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N
vg0613050715 C -> T LOC_Os06g22460.1 downstream_gene_variant ; 4447.0bp to feature; MODIFIER silent_mutation Average:47.967; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N
vg0613050715 C -> T LOC_Os06g22440-LOC_Os06g22450 intergenic_region ; MODIFIER silent_mutation Average:47.967; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0613050715 2.04E-07 NA mr1068 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613050715 7.15E-09 1.05E-12 mr1090 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613050715 4.54E-07 5.08E-07 mr1111 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613050715 2.14E-07 1.20E-09 mr1121 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613050715 NA 1.47E-07 mr1122 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613050715 2.10E-07 NA mr1144 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613050715 1.49E-09 1.20E-13 mr1211 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613050715 2.70E-09 NA mr1068_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613050715 6.21E-12 1.42E-12 mr1090_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613050715 9.84E-07 NA mr1094_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613050715 1.02E-06 NA mr1096_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613050715 6.57E-09 NA mr1111_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613050715 5.90E-10 3.89E-11 mr1121_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613050715 3.56E-09 NA mr1144_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613050715 4.24E-07 NA mr1200_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613050715 3.17E-12 3.36E-15 mr1211_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613050715 NA 3.16E-07 mr1632_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251