\
| Variant ID: vg0613034657 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 13034657 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TTTATCATTATTGTATGACTGTTATTATTGTACGAATAATTATTTGTGTACGATTTTTTTTCATTTCATGTAGATGGATCGGCAATGGATGTACGCTGAC[T/C]
GGTGGTCCAAAGAGTTTATTGACGGCGTGCATTATTTTTTGAGAGTGACCGAAGCTAACAGGCATAAGGGTTTTATTTGTTGTCCATGCAATAAGTGTAA
TTACACTTATTGCATGGACAACAAATAAAACCCTTATGCCTGTTAGCTTCGGTCACTCTCAAAAAATAATGCACGCCGTCAATAAACTCTTTGGACCACC[A/G]
GTCAGCGTACATCCATTGCCGATCCATCTACATGAAATGAAAAAAAATCGTACACAAATAATTATTCGTACAATAATAACAGTCATACAATAATGATAAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.40% | 30.60% | 2.88% | 0.13% | NA |
| All Indica | 2759 | 96.40% | 2.60% | 0.98% | 0.00% | NA |
| All Japonica | 1512 | 11.40% | 86.50% | 1.92% | 0.20% | NA |
| Aus | 269 | 80.30% | 12.60% | 7.06% | 0.00% | NA |
| Indica I | 595 | 95.80% | 2.70% | 1.51% | 0.00% | NA |
| Indica II | 465 | 97.00% | 2.60% | 0.43% | 0.00% | NA |
| Indica III | 913 | 98.20% | 1.10% | 0.66% | 0.00% | NA |
| Indica Intermediate | 786 | 94.40% | 4.30% | 1.27% | 0.00% | NA |
| Temperate Japonica | 767 | 3.70% | 92.80% | 3.13% | 0.39% | NA |
| Tropical Japonica | 504 | 23.80% | 76.00% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 10.00% | 88.40% | 1.66% | 0.00% | NA |
| VI/Aromatic | 96 | 40.60% | 1.00% | 55.21% | 3.12% | NA |
| Intermediate | 90 | 56.70% | 34.40% | 8.89% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0613034657 | T -> C | LOC_Os06g22420.1 | upstream_gene_variant ; 2591.0bp to feature; MODIFIER | silent_mutation | Average:22.53; most accessible tissue: Minghui63 young leaf, score: 31.294 | N | N | N | N |
| vg0613034657 | T -> C | LOC_Os06g22430.1 | upstream_gene_variant ; 337.0bp to feature; MODIFIER | silent_mutation | Average:22.53; most accessible tissue: Minghui63 young leaf, score: 31.294 | N | N | N | N |
| vg0613034657 | T -> C | LOC_Os06g22410.1 | downstream_gene_variant ; 4475.0bp to feature; MODIFIER | silent_mutation | Average:22.53; most accessible tissue: Minghui63 young leaf, score: 31.294 | N | N | N | N |
| vg0613034657 | T -> C | LOC_Os06g22420-LOC_Os06g22430 | intergenic_region ; MODIFIER | silent_mutation | Average:22.53; most accessible tissue: Minghui63 young leaf, score: 31.294 | N | N | N | N |
| vg0613034657 | T -> DEL | N | N | silent_mutation | Average:22.53; most accessible tissue: Minghui63 young leaf, score: 31.294 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0613034657 | NA | 1.65E-07 | mr1033 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613034657 | NA | 3.16E-07 | mr1076 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613034657 | NA | 9.56E-10 | mr1082 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613034657 | 5.35E-09 | 3.80E-12 | mr1083 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613034657 | NA | 2.32E-07 | mr1086 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613034657 | NA | 3.51E-08 | mr1103 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613034657 | NA | 3.18E-07 | mr1107 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613034657 | NA | 4.49E-06 | mr1139 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613034657 | NA | 1.11E-06 | mr1176 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613034657 | NA | 1.44E-06 | mr1204 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613034657 | NA | 1.27E-11 | mr1226 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613034657 | NA | 5.75E-08 | mr1411 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613034657 | NA | 2.74E-06 | mr1436 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613034657 | NA | 5.38E-08 | mr1437 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613034657 | NA | 3.13E-06 | mr1560 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |