\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0613034657:

Variant ID: vg0613034657 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 13034657
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTATCATTATTGTATGACTGTTATTATTGTACGAATAATTATTTGTGTACGATTTTTTTTCATTTCATGTAGATGGATCGGCAATGGATGTACGCTGAC[T/C]
GGTGGTCCAAAGAGTTTATTGACGGCGTGCATTATTTTTTGAGAGTGACCGAAGCTAACAGGCATAAGGGTTTTATTTGTTGTCCATGCAATAAGTGTAA

Reverse complement sequence

TTACACTTATTGCATGGACAACAAATAAAACCCTTATGCCTGTTAGCTTCGGTCACTCTCAAAAAATAATGCACGCCGTCAATAAACTCTTTGGACCACC[A/G]
GTCAGCGTACATCCATTGCCGATCCATCTACATGAAATGAAAAAAAATCGTACACAAATAATTATTCGTACAATAATAACAGTCATACAATAATGATAAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.40% 30.60% 2.88% 0.13% NA
All Indica  2759 96.40% 2.60% 0.98% 0.00% NA
All Japonica  1512 11.40% 86.50% 1.92% 0.20% NA
Aus  269 80.30% 12.60% 7.06% 0.00% NA
Indica I  595 95.80% 2.70% 1.51% 0.00% NA
Indica II  465 97.00% 2.60% 0.43% 0.00% NA
Indica III  913 98.20% 1.10% 0.66% 0.00% NA
Indica Intermediate  786 94.40% 4.30% 1.27% 0.00% NA
Temperate Japonica  767 3.70% 92.80% 3.13% 0.39% NA
Tropical Japonica  504 23.80% 76.00% 0.20% 0.00% NA
Japonica Intermediate  241 10.00% 88.40% 1.66% 0.00% NA
VI/Aromatic  96 40.60% 1.00% 55.21% 3.12% NA
Intermediate  90 56.70% 34.40% 8.89% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0613034657 T -> C LOC_Os06g22420.1 upstream_gene_variant ; 2591.0bp to feature; MODIFIER silent_mutation Average:22.53; most accessible tissue: Minghui63 young leaf, score: 31.294 N N N N
vg0613034657 T -> C LOC_Os06g22430.1 upstream_gene_variant ; 337.0bp to feature; MODIFIER silent_mutation Average:22.53; most accessible tissue: Minghui63 young leaf, score: 31.294 N N N N
vg0613034657 T -> C LOC_Os06g22410.1 downstream_gene_variant ; 4475.0bp to feature; MODIFIER silent_mutation Average:22.53; most accessible tissue: Minghui63 young leaf, score: 31.294 N N N N
vg0613034657 T -> C LOC_Os06g22420-LOC_Os06g22430 intergenic_region ; MODIFIER silent_mutation Average:22.53; most accessible tissue: Minghui63 young leaf, score: 31.294 N N N N
vg0613034657 T -> DEL N N silent_mutation Average:22.53; most accessible tissue: Minghui63 young leaf, score: 31.294 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0613034657 NA 1.65E-07 mr1033 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613034657 NA 3.16E-07 mr1076 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613034657 NA 9.56E-10 mr1082 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613034657 5.35E-09 3.80E-12 mr1083 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613034657 NA 2.32E-07 mr1086 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613034657 NA 3.51E-08 mr1103 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613034657 NA 3.18E-07 mr1107 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613034657 NA 4.49E-06 mr1139 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613034657 NA 1.11E-06 mr1176 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613034657 NA 1.44E-06 mr1204 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613034657 NA 1.27E-11 mr1226 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613034657 NA 5.75E-08 mr1411 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613034657 NA 2.74E-06 mr1436 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613034657 NA 5.38E-08 mr1437 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613034657 NA 3.13E-06 mr1560 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251