\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0613034067:

Variant ID: vg0613034067 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 13034067
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGTCAAATGCTGTCAGGGCTTGTCAGGCCCCCCCGGGATCTTTAGTCCCGGTTTTTAACACCAACTGGGACTAAAGTCCCACCCCTTTATATATGTCTTC[C/T]
TCCTCCTCCAGCCCGAGCAAGCTTCAAAATTTATTCAAAAAAGAGGAGAGGTCATGCCAAAATTTCTAGTGAATTTATTTTGGTGATTATATACAAATCG

Reverse complement sequence

CGATTTGTATATAATCACCAAAATAAATTCACTAGAAATTTTGGCATGACCTCTCCTCTTTTTTGAATAAATTTTGAAGCTTGCTCGGGCTGGAGGAGGA[G/A]
GAAGACATATATAAAGGGGTGGGACTTTAGTCCCAGTTGGTGTTAAAAACCGGGACTAAAGATCCCGGGGGGGCCTGACAAGCCCTGACAGCATTTGACT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.40% 30.10% 1.35% 0.17% NA
All Indica  2759 97.60% 2.00% 0.33% 0.07% NA
All Japonica  1512 13.60% 86.30% 0.07% 0.00% NA
Aus  269 86.60% 12.30% 0.74% 0.37% NA
Indica I  595 97.30% 2.40% 0.34% 0.00% NA
Indica II  465 97.40% 2.40% 0.22% 0.00% NA
Indica III  913 99.60% 0.20% 0.22% 0.00% NA
Indica Intermediate  786 95.80% 3.40% 0.51% 0.25% NA
Temperate Japonica  767 7.30% 92.70% 0.00% 0.00% NA
Tropical Japonica  504 24.20% 75.80% 0.00% 0.00% NA
Japonica Intermediate  241 11.60% 88.00% 0.41% 0.00% NA
VI/Aromatic  96 43.80% 1.00% 50.00% 5.21% NA
Intermediate  90 62.20% 33.30% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0613034067 C -> T LOC_Os06g22420.1 upstream_gene_variant ; 2001.0bp to feature; MODIFIER silent_mutation Average:33.291; most accessible tissue: Callus, score: 43.255 N N N N
vg0613034067 C -> T LOC_Os06g22430.1 upstream_gene_variant ; 927.0bp to feature; MODIFIER silent_mutation Average:33.291; most accessible tissue: Callus, score: 43.255 N N N N
vg0613034067 C -> T LOC_Os06g22410.1 downstream_gene_variant ; 3885.0bp to feature; MODIFIER silent_mutation Average:33.291; most accessible tissue: Callus, score: 43.255 N N N N
vg0613034067 C -> T LOC_Os06g22420-LOC_Os06g22430 intergenic_region ; MODIFIER silent_mutation Average:33.291; most accessible tissue: Callus, score: 43.255 N N N N
vg0613034067 C -> DEL N N silent_mutation Average:33.291; most accessible tissue: Callus, score: 43.255 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0613034067 NA 2.50E-22 mr1020 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613034067 2.69E-07 2.51E-80 mr1100 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613034067 1.28E-06 1.28E-06 mr1165 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613034067 NA 4.42E-39 mr1402 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613034067 NA 1.17E-21 mr1477 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613034067 NA 4.00E-10 mr1630 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613034067 NA 7.48E-37 mr1719 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613034067 NA 5.85E-13 mr1740 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613034067 8.75E-06 NA mr1962 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613034067 NA 7.34E-22 mr1971 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251