Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0613034067:

Variant ID: vg0613034067 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 13034067
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AGTCAAATGCTGTCAGGGCTTGTCAGGCCCCCCCGGGATCTTTAGTCCCGGTTTTTAACACCAACTGGGACTAAAGTCCCACCCCTTTATATATGTCTTC[C/T]
TCCTCCTCCAGCCCGAGCAAGCTTCAAAATTTATTCAAAAAAGAGGAGAGGTCATGCCAAAATTTCTAGTGAATTTATTTTGGTGATTATATACAAATCG

Reverse complement sequence

CGATTTGTATATAATCACCAAAATAAATTCACTAGAAATTTTGGCATGACCTCTCCTCTTTTTTGAATAAATTTTGAAGCTTGCTCGGGCTGGAGGAGGA[G/A]
GAAGACATATATAAAGGGGTGGGACTTTAGTCCCAGTTGGTGTTAAAAACCGGGACTAAAGATCCCGGGGGGGCCTGACAAGCCCTGACAGCATTTGACT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	68.40%	30.10%	1.35%	0.17%	NA
All Indica	2759	97.60%	2.00%	0.33%	0.07%	NA
All Japonica	1512	13.60%	86.30%	0.07%	0.00%	NA
Aus	269	86.60%	12.30%	0.74%	0.37%	NA
Indica I	595	97.30%	2.40%	0.34%	0.00%	NA
Indica II	465	97.40%	2.40%	0.22%	0.00%	NA
Indica III	913	99.60%	0.20%	0.22%	0.00%	NA
Indica Intermediate	786	95.80%	3.40%	0.51%	0.25%	NA
Temperate Japonica	767	7.30%	92.70%	0.00%	0.00%	NA
Tropical Japonica	504	24.20%	75.80%	0.00%	0.00%	NA
Japonica Intermediate	241	11.60%	88.00%	0.41%	0.00%	NA
VI/Aromatic	96	43.80%	1.00%	50.00%	5.21%	NA
Intermediate	90	62.20%	33.30%	4.44%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0613034067	C -> T	LOC_Os06g22420.1	upstream_gene_variant ; 2001.0bp to feature; MODIFIER	silent_mutation	Average:33.291; most accessible tissue: Callus, score: 43.255	N	N	N	N
vg0613034067	C -> T	LOC_Os06g22430.1	upstream_gene_variant ; 927.0bp to feature; MODIFIER	silent_mutation	Average:33.291; most accessible tissue: Callus, score: 43.255	N	N	N	N
vg0613034067	C -> T	LOC_Os06g22410.1	downstream_gene_variant ; 3885.0bp to feature; MODIFIER	silent_mutation	Average:33.291; most accessible tissue: Callus, score: 43.255	N	N	N	N
vg0613034067	C -> T	LOC_Os06g22420-LOC_Os06g22430	intergenic_region ; MODIFIER	silent_mutation	Average:33.291; most accessible tissue: Callus, score: 43.255	N	N	N	N
vg0613034067	C -> DEL	N	N	silent_mutation	Average:33.291; most accessible tissue: Callus, score: 43.255	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0613034067	NA	2.50E-22	mr1020	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613034067	2.69E-07	2.51E-80	mr1100	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613034067	1.28E-06	1.28E-06	mr1165	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613034067	NA	4.42E-39	mr1402	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613034067	NA	1.17E-21	mr1477	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613034067	NA	4.00E-10	mr1630	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613034067	NA	7.48E-37	mr1719	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613034067	NA	5.85E-13	mr1740	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613034067	8.75E-06	NA	mr1962	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613034067	NA	7.34E-22	mr1971	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251