Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0613011483:

Variant ID: vg0613011483 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 13011483
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATGCACTCCTAGTACTTCGAGAAGCCACCCCTAACTGCCGAGTTCCTTACGATAACCCGTCATGACCATACAACCAGGGCTAAATACGGAGGAATACCCT[T/C]
CCCAAGGAATTAACTTAGGATTATATATCGGCATGAAGGAATACTTGTACTGAGCTGTCACCATCAGCGGCCCACCTCTCATCCGCAATATATAACCCCA

Reverse complement sequence

TGGGGTTATATATTGCGGATGAGAGGTGGGCCGCTGATGGTGACAGCTCAGTACAAGTATTCCTTCATGCCGATATATAATCCTAAGTTAATTCCTTGGG[A/G]
AGGGTATTCCTCCGTATTTAGCCCTGGTTGTATGGTCATGACGGGTTATCGTAAGGAACTCGGCAGTTAGGGGTGGCTTCTCGAAGTACTAGGAGTGCAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.90%	30.70%	6.35%	4.06%	NA
All Indica	2759	84.80%	2.80%	7.83%	4.60%	NA
All Japonica	1512	11.40%	86.60%	1.85%	0.13%	NA
Aus	269	71.70%	12.30%	13.75%	2.23%	NA
Indica I	595	82.90%	3.20%	11.26%	2.69%	NA
Indica II	465	82.40%	3.70%	9.03%	4.95%	NA
Indica III	913	90.10%	0.50%	4.49%	4.82%	NA
Indica Intermediate	786	81.60%	4.50%	8.40%	5.60%	NA
Temperate Japonica	767	3.30%	93.00%	3.65%	0.13%	NA
Tropical Japonica	504	24.00%	76.00%	0.00%	0.00%	NA
Japonica Intermediate	241	11.20%	88.40%	0.00%	0.41%	NA
VI/Aromatic	96	34.40%	1.00%	8.33%	56.25%	NA
Intermediate	90	47.80%	36.70%	12.22%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0613011483	T -> C	LOC_Os06g22394.1	upstream_gene_variant ; 864.0bp to feature; MODIFIER	silent_mutation	Average:19.219; most accessible tissue: Callus, score: 51.501	N	N	N	N
vg0613011483	T -> C	LOC_Os06g22394-LOC_Os06g22400	intergenic_region ; MODIFIER	silent_mutation	Average:19.219; most accessible tissue: Callus, score: 51.501	N	N	N	N
vg0613011483	T -> DEL	N	N	silent_mutation	Average:19.219; most accessible tissue: Callus, score: 51.501	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0613011483	NA	1.16E-08	mr1033	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613011483	NA	1.61E-07	mr1082	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613011483	NA	8.70E-08	mr1083	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613011483	NA	1.49E-08	mr1103	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613011483	NA	1.11E-07	mr1107	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613011483	NA	2.35E-07	mr1145	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613011483	NA	2.94E-07	mr1162	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613011483	NA	1.43E-08	mr1176	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613011483	NA	1.50E-08	mr1226	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613011483	NA	2.87E-06	mr1408	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613011483	NA	8.27E-07	mr1411	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613011483	NA	3.75E-06	mr1436	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613011483	NA	4.38E-07	mr1437	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613011483	NA	6.53E-20	mr1541	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613011483	NA	3.61E-06	mr1560	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613011483	NA	4.60E-10	mr1630	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613011483	NA	3.37E-09	mr1070_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613011483	2.12E-06	NA	mr1083_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613011483	NA	7.19E-08	mr1088_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613011483	1.30E-06	NA	mr1104_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613011483	NA	7.89E-19	mr1165_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613011483	NA	5.45E-07	mr1227_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613011483	NA	4.01E-08	mr1241_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613011483	NA	8.08E-07	mr1264_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613011483	NA	3.27E-06	mr1536_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613011483	NA	7.39E-07	mr1620_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613011483	NA	3.35E-06	mr1878_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251