\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0613011483:

Variant ID: vg0613011483 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 13011483
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATGCACTCCTAGTACTTCGAGAAGCCACCCCTAACTGCCGAGTTCCTTACGATAACCCGTCATGACCATACAACCAGGGCTAAATACGGAGGAATACCCT[T/C]
CCCAAGGAATTAACTTAGGATTATATATCGGCATGAAGGAATACTTGTACTGAGCTGTCACCATCAGCGGCCCACCTCTCATCCGCAATATATAACCCCA

Reverse complement sequence

TGGGGTTATATATTGCGGATGAGAGGTGGGCCGCTGATGGTGACAGCTCAGTACAAGTATTCCTTCATGCCGATATATAATCCTAAGTTAATTCCTTGGG[A/G]
AGGGTATTCCTCCGTATTTAGCCCTGGTTGTATGGTCATGACGGGTTATCGTAAGGAACTCGGCAGTTAGGGGTGGCTTCTCGAAGTACTAGGAGTGCAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.90% 30.70% 6.35% 4.06% NA
All Indica  2759 84.80% 2.80% 7.83% 4.60% NA
All Japonica  1512 11.40% 86.60% 1.85% 0.13% NA
Aus  269 71.70% 12.30% 13.75% 2.23% NA
Indica I  595 82.90% 3.20% 11.26% 2.69% NA
Indica II  465 82.40% 3.70% 9.03% 4.95% NA
Indica III  913 90.10% 0.50% 4.49% 4.82% NA
Indica Intermediate  786 81.60% 4.50% 8.40% 5.60% NA
Temperate Japonica  767 3.30% 93.00% 3.65% 0.13% NA
Tropical Japonica  504 24.00% 76.00% 0.00% 0.00% NA
Japonica Intermediate  241 11.20% 88.40% 0.00% 0.41% NA
VI/Aromatic  96 34.40% 1.00% 8.33% 56.25% NA
Intermediate  90 47.80% 36.70% 12.22% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0613011483 T -> C LOC_Os06g22394.1 upstream_gene_variant ; 864.0bp to feature; MODIFIER silent_mutation Average:19.219; most accessible tissue: Callus, score: 51.501 N N N N
vg0613011483 T -> C LOC_Os06g22394-LOC_Os06g22400 intergenic_region ; MODIFIER silent_mutation Average:19.219; most accessible tissue: Callus, score: 51.501 N N N N
vg0613011483 T -> DEL N N silent_mutation Average:19.219; most accessible tissue: Callus, score: 51.501 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0613011483 NA 1.16E-08 mr1033 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613011483 NA 1.61E-07 mr1082 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613011483 NA 8.70E-08 mr1083 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613011483 NA 1.49E-08 mr1103 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613011483 NA 1.11E-07 mr1107 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613011483 NA 2.35E-07 mr1145 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613011483 NA 2.94E-07 mr1162 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613011483 NA 1.43E-08 mr1176 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613011483 NA 1.50E-08 mr1226 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613011483 NA 2.87E-06 mr1408 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613011483 NA 8.27E-07 mr1411 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613011483 NA 3.75E-06 mr1436 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613011483 NA 4.38E-07 mr1437 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613011483 NA 6.53E-20 mr1541 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613011483 NA 3.61E-06 mr1560 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613011483 NA 4.60E-10 mr1630 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613011483 NA 3.37E-09 mr1070_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613011483 2.12E-06 NA mr1083_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613011483 NA 7.19E-08 mr1088_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613011483 1.30E-06 NA mr1104_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613011483 NA 7.89E-19 mr1165_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613011483 NA 5.45E-07 mr1227_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613011483 NA 4.01E-08 mr1241_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613011483 NA 8.08E-07 mr1264_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613011483 NA 3.27E-06 mr1536_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613011483 NA 7.39E-07 mr1620_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613011483 NA 3.35E-06 mr1878_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251