\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0613011415:

Variant ID: vg0613011415 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 13011415
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATACTTCTAATATACATAGTATACATATATTCTAGTTAACCAAAATACTAGCTAATACCCTCTATCCGATGCACTCCTAGTACTTCGAGAAGCCACCCCT[A/G]
ACTGCCGAGTTCCTTACGATAACCCGTCATGACCATACAACCAGGGCTAAATACGGAGGAATACCCTTCCCAAGGAATTAACTTAGGATTATATATCGGC

Reverse complement sequence

GCCGATATATAATCCTAAGTTAATTCCTTGGGAAGGGTATTCCTCCGTATTTAGCCCTGGTTGTATGGTCATGACGGGTTATCGTAAGGAACTCGGCAGT[T/C]
AGGGGTGGCTTCTCGAAGTACTAGGAGTGCATCGGATAGAGGGTATTAGCTAGTATTTTGGTTAACTAGAATATATGTATACTATGTATATTAGAAGTAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.90% 30.40% 0.36% 1.33% NA
All Indica  2759 97.10% 2.30% 0.36% 0.25% NA
All Japonica  1512 13.30% 86.60% 0.13% 0.00% NA
Aus  269 86.20% 12.30% 0.37% 1.12% NA
Indica I  595 96.10% 2.70% 1.18% 0.00% NA
Indica II  465 96.60% 3.00% 0.43% 0.00% NA
Indica III  913 98.90% 0.80% 0.11% 0.22% NA
Indica Intermediate  786 95.90% 3.40% 0.00% 0.64% NA
Temperate Japonica  767 6.90% 92.80% 0.26% 0.00% NA
Tropical Japonica  504 24.00% 76.00% 0.00% 0.00% NA
Japonica Intermediate  241 11.20% 88.80% 0.00% 0.00% NA
VI/Aromatic  96 43.80% 1.00% 3.12% 52.08% NA
Intermediate  90 62.20% 33.30% 1.11% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0613011415 A -> G LOC_Os06g22394.1 upstream_gene_variant ; 796.0bp to feature; MODIFIER silent_mutation Average:18.976; most accessible tissue: Callus, score: 33.517 N N N N
vg0613011415 A -> G LOC_Os06g22394-LOC_Os06g22400 intergenic_region ; MODIFIER silent_mutation Average:18.976; most accessible tissue: Callus, score: 33.517 N N N N
vg0613011415 A -> DEL N N silent_mutation Average:18.976; most accessible tissue: Callus, score: 33.517 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0613011415 NA 2.96E-09 mr1076 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613011415 1.29E-07 2.64E-13 mr1082 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613011415 2.84E-10 2.28E-13 mr1083 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613011415 NA 1.27E-07 mr1085 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613011415 3.92E-06 3.35E-09 mr1086 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613011415 NA 8.20E-06 mr1088 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613011415 NA 4.39E-10 mr1103 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613011415 3.69E-08 1.06E-10 mr1104 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613011415 NA 3.46E-08 mr1107 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613011415 NA 2.82E-09 mr1139 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613011415 NA 9.46E-07 mr1145 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613011415 NA 4.82E-07 mr1204 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613011415 6.67E-06 1.02E-06 mr1225 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613011415 NA 1.42E-10 mr1226 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613011415 NA 5.82E-08 mr1301 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613011415 NA 4.35E-06 mr1408 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613011415 3.33E-08 8.01E-13 mr1411 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613011415 NA 8.13E-08 mr1436 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613011415 NA 8.86E-09 mr1437 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613011415 NA 5.75E-09 mr1560 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613011415 NA 1.20E-07 mr1620 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613011415 NA 7.79E-13 mr1740 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613011415 1.50E-07 4.05E-10 mr1878 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613011415 NA 8.81E-09 mr1949 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251