Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0612980757:

Variant ID: vg0612980757 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 12980757
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAAACAAAGGAAAGAAAAGAAAGAAAAGGGTGGATAATTTGATAGAAATCGCTCAAGGGGACAATGGACAAATTCTTGAGATAATATTACTCCCTCTGTC[C/T]
CATGATATAAGACGTGCACACATTTCAAGATTTAACTTTAAAAATATTTGATCAACAATTATTATAATATAAATTAAATTTTATTTGTTATAAAATTAAT

Reverse complement sequence

ATTAATTTTATAACAAATAAAATTTAATTTATATTATAATAATTGTTGATCAAATATTTTTAAAGTTAAATCTTGAAATGTGTGCACGTCTTATATCATG[G/A]
GACAGAGGGAGTAATATTATCTCAAGAATTTGTCCATTGTCCCCTTGAGCGATTTCTATCAAATTATCCACCCTTTTCTTTCTTTTCTTTCCTTTGTTTC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.20% 36.40% 0.19% 0.17% NA
All Indica  2759 95.70% 4.10% 0.07% 0.11% NA
All Japonica  1512 2.60% 96.80% 0.40% 0.26% NA
Aus  269 81.40% 18.60% 0.00% 0.00% NA
Indica I  595 94.80% 5.20% 0.00% 0.00% NA
Indica II  465 96.30% 3.40% 0.00% 0.22% NA
Indica III  913 98.90% 0.80% 0.11% 0.22% NA
Indica Intermediate  786 92.40% 7.50% 0.13% 0.00% NA
Temperate Japonica  767 3.10% 96.00% 0.39% 0.52% NA
Tropical Japonica  504 1.20% 98.20% 0.60% 0.00% NA
Japonica Intermediate  241 3.70% 96.30% 0.00% 0.00% NA
VI/Aromatic  96 39.60% 60.40% 0.00% 0.00% NA
Intermediate  90 57.80% 40.00% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0612980757 C -> T LOC_Os06g22350.1 upstream_gene_variant ; 2301.0bp to feature; MODIFIER silent_mutation Average:34.555; most accessible tissue: Callus, score: 72.072 N N N N
vg0612980757 C -> T LOC_Os06g22360.1 upstream_gene_variant ; 2409.0bp to feature; MODIFIER silent_mutation Average:34.555; most accessible tissue: Callus, score: 72.072 N N N N
vg0612980757 C -> T LOC_Os06g22350-LOC_Os06g22360 intergenic_region ; MODIFIER silent_mutation Average:34.555; most accessible tissue: Callus, score: 72.072 N N N N
vg0612980757 C -> DEL N N silent_mutation Average:34.555; most accessible tissue: Callus, score: 72.072 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0612980757 NA 1.20E-37 mr1064 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612980757 NA 2.23E-57 mr1087 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612980757 NA 6.94E-06 mr1103 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612980757 NA 6.33E-06 mr1104 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612980757 NA 3.00E-06 mr1107 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612980757 4.85E-06 NA mr1111 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612980757 NA 3.54E-07 mr1111 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612980757 8.64E-06 NA mr1112 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612980757 2.84E-07 NA mr1144 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612980757 NA 6.13E-07 mr1144 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612980757 NA 2.38E-21 mr1155 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612980757 NA 1.26E-28 mr1202 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612980757 NA 7.61E-09 mr1301 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612980757 NA 1.88E-06 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612980757 NA 4.49E-41 mr1534 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612980757 NA 8.19E-33 mr1733 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612980757 NA 2.20E-53 mr1861 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612980757 NA 6.41E-73 mr1087_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612980757 3.59E-07 NA mr1108_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612980757 NA 2.90E-10 mr1108_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612980757 1.58E-06 NA mr1111_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612980757 NA 1.87E-09 mr1111_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612980757 NA 1.17E-08 mr1112_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612980757 2.26E-06 NA mr1144_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612980757 NA 1.62E-07 mr1144_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612980757 NA 4.10E-08 mr1155_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612980757 NA 5.25E-18 mr1199_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612980757 NA 5.82E-11 mr1216_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612980757 NA 2.86E-14 mr1333_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612980757 NA 2.41E-24 mr1403_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612980757 NA 1.80E-07 mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612980757 NA 1.07E-56 mr1526_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612980757 NA 3.85E-22 mr1551_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612980757 NA 5.21E-08 mr1783_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612980757 NA 1.28E-07 mr1804_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612980757 NA 5.35E-07 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251