\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0612956044:

Variant ID: vg0612956044 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 12956044
Reference Allele: TAlternative Allele: C,G
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGCGGCCATGGCGGCAGTTGGAGCTGGAGGAAGGGGATGACAGGTGGGGTCCACGGGTCCCACCTGTCGGGGAGAGAGGGAGGGAGAGTTGGAAGGGGGA[T/C,G]
GTAAAACAGACTTTGCGAGGGAGAGGGGAAACGGGCTGACGGCCGAAGAGATTAGAGGGGAGGCCGGCCGAGGAAGGGAGAGAAGGAGGGCTTTGGCCCA

Reverse complement sequence

TGGGCCAAAGCCCTCCTTCTCTCCCTTCCTCGGCCGGCCTCCCCTCTAATCTCTTCGGCCGTCAGCCCGTTTCCCCTCTCCCTCGCAAAGTCTGTTTTAC[A/G,C]
TCCCCCTTCCAACTCTCCCTCCCTCTCTCCCCGACAGGTGGGACCCGTGGACCCCACCTGTCATCCCCTTCCTCCAGCTCCAACTGCCGCCATGGCCGCC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.30% 33.80% 1.29% 0.63% NA
All Indica  2759 95.70% 2.20% 1.38% 0.72% NA
All Japonica  1512 2.80% 96.90% 0.26% 0.00% NA
Aus  269 81.40% 13.40% 4.09% 1.12% NA
Indica I  595 95.50% 2.50% 1.85% 0.17% NA
Indica II  465 92.30% 2.60% 3.23% 1.94% NA
Indica III  913 98.70% 0.70% 0.44% 0.22% NA
Indica Intermediate  786 94.30% 3.70% 1.02% 1.02% NA
Temperate Japonica  767 3.00% 96.90% 0.13% 0.00% NA
Tropical Japonica  504 2.00% 98.00% 0.00% 0.00% NA
Japonica Intermediate  241 4.10% 94.60% 1.24% 0.00% NA
VI/Aromatic  96 89.60% 2.10% 1.04% 7.29% NA
Intermediate  90 56.70% 35.60% 7.78% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0612956044 T -> C LOC_Os06g22310.1 upstream_gene_variant ; 2103.0bp to feature; MODIFIER silent_mutation Average:54.011; most accessible tissue: Minghui63 panicle, score: 68.46 N N N N
vg0612956044 T -> C LOC_Os06g22300.1 downstream_gene_variant ; 3851.0bp to feature; MODIFIER silent_mutation Average:54.011; most accessible tissue: Minghui63 panicle, score: 68.46 N N N N
vg0612956044 T -> C LOC_Os06g22320.1 downstream_gene_variant ; 347.0bp to feature; MODIFIER silent_mutation Average:54.011; most accessible tissue: Minghui63 panicle, score: 68.46 N N N N
vg0612956044 T -> C LOC_Os06g22310-LOC_Os06g22320 intergenic_region ; MODIFIER silent_mutation Average:54.011; most accessible tissue: Minghui63 panicle, score: 68.46 N N N N
vg0612956044 T -> G LOC_Os06g22310.1 upstream_gene_variant ; 2103.0bp to feature; MODIFIER N Average:54.011; most accessible tissue: Minghui63 panicle, score: 68.46 N N N N
vg0612956044 T -> G LOC_Os06g22300.1 downstream_gene_variant ; 3851.0bp to feature; MODIFIER N Average:54.011; most accessible tissue: Minghui63 panicle, score: 68.46 N N N N
vg0612956044 T -> G LOC_Os06g22320.1 downstream_gene_variant ; 347.0bp to feature; MODIFIER N Average:54.011; most accessible tissue: Minghui63 panicle, score: 68.46 N N N N
vg0612956044 T -> G LOC_Os06g22310-LOC_Os06g22320 intergenic_region ; MODIFIER N Average:54.011; most accessible tissue: Minghui63 panicle, score: 68.46 N N N N
vg0612956044 T -> DEL N N silent_mutation Average:54.011; most accessible tissue: Minghui63 panicle, score: 68.46 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0612956044 NA 5.00E-19 Yield All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0612956044 NA 1.27E-39 mr1064 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612956044 NA 7.31E-28 mr1072 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612956044 NA 1.27E-29 mr1075 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612956044 NA 2.83E-56 mr1087 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612956044 NA 1.32E-78 mr1100 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612956044 NA 2.39E-10 mr1195 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612956044 NA 6.40E-12 mr1281 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612956044 NA 4.24E-09 mr1342 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612956044 NA 1.76E-20 mr1477 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612956044 NA 2.30E-43 mr1534 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612956044 NA 4.50E-21 mr1541 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612956044 NA 3.08E-22 mr1548 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612956044 NA 3.21E-21 mr1566 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612956044 NA 1.85E-20 mr1588 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612956044 NA 1.62E-11 mr1713 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612956044 NA 4.22E-33 mr1733 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612956044 NA 1.29E-56 mr1795 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612956044 NA 1.69E-07 mr1804 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612956044 NA 2.06E-54 mr1861 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612956044 NA 1.22E-59 mr1962 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612956044 NA 1.01E-18 mr1165_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612956044 NA 1.46E-14 mr1333_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612956044 NA 1.53E-30 mr1477_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612956044 NA 9.54E-22 mr1551_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612956044 NA 7.91E-22 mr1609_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612956044 NA 1.08E-47 mr1721_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612956044 NA 1.27E-07 mr1783_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251