Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0612956044:

Variant ID: vg0612956044 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 12956044
Reference Allele: T	Alternative Allele: C,G
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGCGGCCATGGCGGCAGTTGGAGCTGGAGGAAGGGGATGACAGGTGGGGTCCACGGGTCCCACCTGTCGGGGAGAGAGGGAGGGAGAGTTGGAAGGGGGA[T/C,G]
GTAAAACAGACTTTGCGAGGGAGAGGGGAAACGGGCTGACGGCCGAAGAGATTAGAGGGGAGGCCGGCCGAGGAAGGGAGAGAAGGAGGGCTTTGGCCCA

Reverse complement sequence

TGGGCCAAAGCCCTCCTTCTCTCCCTTCCTCGGCCGGCCTCCCCTCTAATCTCTTCGGCCGTCAGCCCGTTTCCCCTCTCCCTCGCAAAGTCTGTTTTAC[A/G,C]
TCCCCCTTCCAACTCTCCCTCCCTCTCTCCCCGACAGGTGGGACCCGTGGACCCCACCTGTCATCCCCTTCCTCCAGCTCCAACTGCCGCCATGGCCGCC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.30%	33.80%	1.29%	0.63%	NA
All Indica	2759	95.70%	2.20%	1.38%	0.72%	NA
All Japonica	1512	2.80%	96.90%	0.26%	0.00%	NA
Aus	269	81.40%	13.40%	4.09%	1.12%	NA
Indica I	595	95.50%	2.50%	1.85%	0.17%	NA
Indica II	465	92.30%	2.60%	3.23%	1.94%	NA
Indica III	913	98.70%	0.70%	0.44%	0.22%	NA
Indica Intermediate	786	94.30%	3.70%	1.02%	1.02%	NA
Temperate Japonica	767	3.00%	96.90%	0.13%	0.00%	NA
Tropical Japonica	504	2.00%	98.00%	0.00%	0.00%	NA
Japonica Intermediate	241	4.10%	94.60%	1.24%	0.00%	NA
VI/Aromatic	96	89.60%	2.10%	1.04%	7.29%	NA
Intermediate	90	56.70%	35.60%	7.78%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0612956044	T -> C	LOC_Os06g22310.1	upstream_gene_variant ; 2103.0bp to feature; MODIFIER	silent_mutation	Average:54.011; most accessible tissue: Minghui63 panicle, score: 68.46	N	N	N	N
vg0612956044	T -> C	LOC_Os06g22300.1	downstream_gene_variant ; 3851.0bp to feature; MODIFIER	silent_mutation	Average:54.011; most accessible tissue: Minghui63 panicle, score: 68.46	N	N	N	N
vg0612956044	T -> C	LOC_Os06g22320.1	downstream_gene_variant ; 347.0bp to feature; MODIFIER	silent_mutation	Average:54.011; most accessible tissue: Minghui63 panicle, score: 68.46	N	N	N	N
vg0612956044	T -> C	LOC_Os06g22310-LOC_Os06g22320	intergenic_region ; MODIFIER	silent_mutation	Average:54.011; most accessible tissue: Minghui63 panicle, score: 68.46	N	N	N	N
vg0612956044	T -> G	LOC_Os06g22310.1	upstream_gene_variant ; 2103.0bp to feature; MODIFIER	N	Average:54.011; most accessible tissue: Minghui63 panicle, score: 68.46	N	N	N	N
vg0612956044	T -> G	LOC_Os06g22300.1	downstream_gene_variant ; 3851.0bp to feature; MODIFIER	N	Average:54.011; most accessible tissue: Minghui63 panicle, score: 68.46	N	N	N	N
vg0612956044	T -> G	LOC_Os06g22320.1	downstream_gene_variant ; 347.0bp to feature; MODIFIER	N	Average:54.011; most accessible tissue: Minghui63 panicle, score: 68.46	N	N	N	N
vg0612956044	T -> G	LOC_Os06g22310-LOC_Os06g22320	intergenic_region ; MODIFIER	N	Average:54.011; most accessible tissue: Minghui63 panicle, score: 68.46	N	N	N	N
vg0612956044	T -> DEL	N	N	silent_mutation	Average:54.011; most accessible tissue: Minghui63 panicle, score: 68.46	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0612956044	NA	5.00E-19	Yield	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0612956044	NA	1.27E-39	mr1064	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612956044	NA	7.31E-28	mr1072	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612956044	NA	1.27E-29	mr1075	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612956044	NA	2.83E-56	mr1087	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612956044	NA	1.32E-78	mr1100	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612956044	NA	2.39E-10	mr1195	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612956044	NA	6.40E-12	mr1281	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612956044	NA	4.24E-09	mr1342	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612956044	NA	1.76E-20	mr1477	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612956044	NA	2.30E-43	mr1534	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612956044	NA	4.50E-21	mr1541	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612956044	NA	3.08E-22	mr1548	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612956044	NA	3.21E-21	mr1566	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612956044	NA	1.85E-20	mr1588	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612956044	NA	1.62E-11	mr1713	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612956044	NA	4.22E-33	mr1733	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612956044	NA	1.29E-56	mr1795	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612956044	NA	1.69E-07	mr1804	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612956044	NA	2.06E-54	mr1861	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612956044	NA	1.22E-59	mr1962	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612956044	NA	1.01E-18	mr1165_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612956044	NA	1.46E-14	mr1333_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612956044	NA	1.53E-30	mr1477_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612956044	NA	9.54E-22	mr1551_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612956044	NA	7.91E-22	mr1609_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612956044	NA	1.08E-47	mr1721_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612956044	NA	1.27E-07	mr1783_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251