\
| Variant ID: vg0612880471 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 12880471 |
| Reference Allele: G | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, G: 0.06, others allele: 0.00, population size: 250. )
CTTTCGTTGGAGGCAAGTGCATGATGAACTAATTGTGTGATTCATAGATTGTTTGCTCTATCTATCTATTTCCGTTATATTTCTATGTGGTATGTGACTG[G/C]
TTATGTTCAGACTGTTGTTAATGCCATTTAGATTTCAAATTTATCTTATGTCACGACATTATTCATGTTTTATTATTTCGGATGTTTTATTTCTATTATT
AATAATAGAAATAAAACATCCGAAATAATAAAACATGAATAATGTCGTGACATAAGATAAATTTGAAATCTAAATGGCATTAACAACAGTCTGAACATAA[C/G]
CAGTCACATACCACATAGAAATATAACGGAAATAGATAGATAGAGCAAACAATCTATGAATCACACAATTAGTTCATCATGCACTTGCCTCCAACGAAAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 68.70% | 31.10% | 0.13% | 0.08% | NA |
| All Indica | 2759 | 97.70% | 2.10% | 0.11% | 0.11% | NA |
| All Japonica | 1512 | 11.20% | 88.60% | 0.13% | 0.07% | NA |
| Aus | 269 | 84.40% | 15.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.50% | 2.20% | 0.17% | 0.17% | NA |
| Indica II | 465 | 97.40% | 2.40% | 0.00% | 0.22% | NA |
| Indica III | 913 | 99.70% | 0.20% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 95.80% | 3.90% | 0.13% | 0.13% | NA |
| Temperate Japonica | 767 | 3.00% | 96.70% | 0.13% | 0.13% | NA |
| Tropical Japonica | 504 | 23.80% | 76.00% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 11.20% | 88.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 65.60% | 33.30% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0612880471 | G -> C | LOC_Os06g22200.1 | upstream_gene_variant ; 1165.0bp to feature; MODIFIER | silent_mutation | Average:32.253; most accessible tissue: Minghui63 flag leaf, score: 47.544 | N | N | N | N |
| vg0612880471 | G -> C | LOC_Os06g22190-LOC_Os06g22200 | intergenic_region ; MODIFIER | silent_mutation | Average:32.253; most accessible tissue: Minghui63 flag leaf, score: 47.544 | N | N | N | N |
| vg0612880471 | G -> DEL | N | N | silent_mutation | Average:32.253; most accessible tissue: Minghui63 flag leaf, score: 47.544 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0612880471 | 8.79E-06 | NA | mr1078 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612880471 | NA | 5.04E-56 | mr1087 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612880471 | NA | 5.88E-12 | mr1138 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612880471 | 5.54E-07 | 5.54E-07 | mr1165 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612880471 | NA | 1.10E-07 | mr1354 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612880471 | NA | 5.06E-36 | mr1402 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612880471 | NA | 3.95E-20 | mr1477 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612880471 | 1.14E-07 | 1.14E-07 | mr1478 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612880471 | NA | 1.45E-19 | mr1541 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612880471 | NA | 6.29E-10 | mr1581 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612880471 | NA | 1.38E-20 | mr1588 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612880471 | NA | 1.19E-20 | mr1971 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612880471 | 3.01E-06 | NA | mr1973 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612880471 | NA | 4.21E-08 | mr1165_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |