| Variant ID: vg0612806445 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 12806445 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GCAGCACAGACTTCAAGATGTAATCAAGATGTAATGTATGTATGCTATGTGGGACCAGGTATTAATAGTATAGTAAGTAACTATTGTATGAATTGGCTAT[C/T]
ATATTGGCTATAGATGATTTAGAACTAGTAGAGGGCTATACTATTAAACTTGCTCTTAGAACCGAACCTCCGTCCCAAAATATAAGCATTTTTGACTTCG
CGAAGTCAAAAATGCTTATATTTTGGGACGGAGGTTCGGTTCTAAGAGCAAGTTTAATAGTATAGCCCTCTACTAGTTCTAAATCATCTATAGCCAATAT[G/A]
ATAGCCAATTCATACAATAGTTACTTACTATACTATTAATACCTGGTCCCACATAGCATACATACATTACATCTTGATTACATCTTGAAGTCTGTGCTGC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.40% | 4.60% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 45.70% | 54.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 44.80% | 55.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 7.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0612806445 | C -> T | LOC_Os06g22080.1 | upstream_gene_variant ; 3121.0bp to feature; MODIFIER | silent_mutation | Average:45.414; most accessible tissue: Zhenshan97 root, score: 76.749 | N | N | N | N |
| vg0612806445 | C -> T | LOC_Os06g22080.3 | upstream_gene_variant ; 3205.0bp to feature; MODIFIER | silent_mutation | Average:45.414; most accessible tissue: Zhenshan97 root, score: 76.749 | N | N | N | N |
| vg0612806445 | C -> T | LOC_Os06g22070.1 | downstream_gene_variant ; 2401.0bp to feature; MODIFIER | silent_mutation | Average:45.414; most accessible tissue: Zhenshan97 root, score: 76.749 | N | N | N | N |
| vg0612806445 | C -> T | LOC_Os06g22070-LOC_Os06g22080 | intergenic_region ; MODIFIER | silent_mutation | Average:45.414; most accessible tissue: Zhenshan97 root, score: 76.749 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0612806445 | NA | 3.61E-09 | mr1585 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612806445 | NA | 3.02E-06 | mr1633 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612806445 | 2.33E-06 | NA | mr1987_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |