\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0612805324:

Variant ID: vg0612805324 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 12805324
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCGTTTGTCACAGCTCTAGCTCCCAACTCCAACTTATCTGGAGCTGGAGTTGTATCAAACGGTCTAGATCTTCCTTTTTTTTTTAAGCGGAGTTAGCAGA[G/A]
CTACTACTAGAAAATAAACTACGGGGCTGGAGCTAGGTTTTTGCTGCTCCACAGCTCCACTCCACCCAAAAGACCCACACCCTTTAATTTTTTTATTCTA

Reverse complement sequence

TAGAATAAAAAAATTAAAGGGTGTGGGTCTTTTGGGTGGAGTGGAGCTGTGGAGCAGCAAAAACCTAGCTCCAGCCCCGTAGTTTATTTTCTAGTAGTAG[C/T]
TCTGCTAACTCCGCTTAAAAAAAAAAGGAAGATCTAGACCGTTTGATACAACTCCAGCTCCAGATAAGTTGGAGTTGGGAGCTAGAGCTGTGACAAACGG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.60% 35.20% 0.23% 0.00% NA
All Indica  2759 96.80% 2.80% 0.40% 0.00% NA
All Japonica  1512 4.20% 95.80% 0.00% 0.00% NA
Aus  269 85.50% 14.50% 0.00% 0.00% NA
Indica I  595 96.30% 3.00% 0.67% 0.00% NA
Indica II  465 96.10% 3.90% 0.00% 0.00% NA
Indica III  913 99.00% 0.80% 0.22% 0.00% NA
Indica Intermediate  786 95.00% 4.30% 0.64% 0.00% NA
Temperate Japonica  767 5.70% 94.30% 0.00% 0.00% NA
Tropical Japonica  504 1.80% 98.20% 0.00% 0.00% NA
Japonica Intermediate  241 4.10% 95.90% 0.00% 0.00% NA
VI/Aromatic  96 42.70% 57.30% 0.00% 0.00% NA
Intermediate  90 53.30% 46.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0612805324 G -> A LOC_Os06g22080.1 upstream_gene_variant ; 4242.0bp to feature; MODIFIER silent_mutation Average:64.978; most accessible tissue: Zhenshan97 root, score: 81.772 N N N N
vg0612805324 G -> A LOC_Os06g22080.3 upstream_gene_variant ; 4326.0bp to feature; MODIFIER silent_mutation Average:64.978; most accessible tissue: Zhenshan97 root, score: 81.772 N N N N
vg0612805324 G -> A LOC_Os06g22060.1 downstream_gene_variant ; 4966.0bp to feature; MODIFIER silent_mutation Average:64.978; most accessible tissue: Zhenshan97 root, score: 81.772 N N N N
vg0612805324 G -> A LOC_Os06g22070.1 downstream_gene_variant ; 1280.0bp to feature; MODIFIER silent_mutation Average:64.978; most accessible tissue: Zhenshan97 root, score: 81.772 N N N N
vg0612805324 G -> A LOC_Os06g22060.2 downstream_gene_variant ; 4966.0bp to feature; MODIFIER silent_mutation Average:64.978; most accessible tissue: Zhenshan97 root, score: 81.772 N N N N
vg0612805324 G -> A LOC_Os06g22060.3 downstream_gene_variant ; 4966.0bp to feature; MODIFIER silent_mutation Average:64.978; most accessible tissue: Zhenshan97 root, score: 81.772 N N N N
vg0612805324 G -> A LOC_Os06g22060.4 downstream_gene_variant ; 4966.0bp to feature; MODIFIER silent_mutation Average:64.978; most accessible tissue: Zhenshan97 root, score: 81.772 N N N N
vg0612805324 G -> A LOC_Os06g22060.5 downstream_gene_variant ; 4966.0bp to feature; MODIFIER silent_mutation Average:64.978; most accessible tissue: Zhenshan97 root, score: 81.772 N N N N
vg0612805324 G -> A LOC_Os06g22070-LOC_Os06g22080 intergenic_region ; MODIFIER silent_mutation Average:64.978; most accessible tissue: Zhenshan97 root, score: 81.772 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0612805324 NA 1.02E-21 mr1020 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612805324 NA 3.07E-19 mr1021 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612805324 NA 1.04E-40 mr1064 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612805324 NA 2.75E-80 mr1080 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612805324 2.59E-06 6.41E-87 mr1100 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612805324 NA 4.17E-36 mr1402 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612805324 NA 2.85E-21 mr1477 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612805324 NA 9.05E-19 mr1518 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612805324 NA 4.45E-44 mr1534 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612805324 NA 1.25E-20 mr1541 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612805324 NA 1.52E-17 mr1566 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612805324 NA 6.44E-76 mr1613 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612805324 NA 6.92E-33 mr1733 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612805324 NA 2.02E-29 mr1737 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612805324 NA 2.36E-13 mr1740 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612805324 NA 3.56E-86 mr1758 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612805324 NA 1.43E-56 mr1795 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612805324 NA 1.28E-54 mr1861 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612805324 NA 1.38E-58 mr1962 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612805324 NA 4.98E-59 mr1064_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612805324 NA 1.59E-100 mr1100_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612805324 NA 1.73E-13 mr1326_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612805324 NA 1.55E-64 mr1402_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612805324 NA 2.02E-24 mr1403_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612805324 NA 9.98E-100 mr1619_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612805324 NA 3.81E-19 mr1637_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612805324 NA 3.84E-63 mr1733_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612805324 NA 1.32E-07 mr1804_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251