\
| Variant ID: vg0612613334 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 12613334 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
AGCCAATCCTTAACGAGCCGAGCTGGCTCGTTATCCACCCCTAGTGCTCAGGACAAGCATGCCTTTGAAACTTCAAATGCTTGTGTACCTGTACGGGTAG[A/G]
CGGGTGATCCAGTTTTTGGGGAGCATCCTCCTACGCGACTGCTTTGCATCGGCTATATCTTCTGCTGTTCTGCATTGGCTACATCCTCTGGTACGTCTAC
GTAGACGTACCAGAGGATGTAGCCAATGCAGAACAGCAGAAGATATAGCCGATGCAAAGCAGTCGCGTAGGAGGATGCTCCCCAAAAACTGGATCACCCG[T/C]
CTACCCGTACAGGTACACAAGCATTTGAAGTTTCAAAGGCATGCTTGTCCTGAGCACTAGGGGTGGATAACGAGCCAGCTCGGCTCGTTAAGGATTGGCT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 34.60% | 10.80% | 4.13% | 50.55% | NA |
| All Indica | 2759 | 7.10% | 11.60% | 4.71% | 76.55% | NA |
| All Japonica | 1512 | 89.30% | 2.70% | 3.04% | 4.96% | NA |
| Aus | 269 | 14.90% | 28.60% | 5.58% | 50.93% | NA |
| Indica I | 595 | 12.60% | 7.10% | 3.36% | 76.97% | NA |
| Indica II | 465 | 7.70% | 13.30% | 6.45% | 72.47% | NA |
| Indica III | 913 | 1.10% | 12.50% | 4.82% | 81.60% | NA |
| Indica Intermediate | 786 | 9.70% | 13.00% | 4.58% | 72.77% | NA |
| Temperate Japonica | 767 | 97.30% | 0.50% | 0.26% | 1.96% | NA |
| Tropical Japonica | 504 | 76.60% | 6.70% | 7.94% | 8.73% | NA |
| Japonica Intermediate | 241 | 90.50% | 1.20% | 1.66% | 6.64% | NA |
| VI/Aromatic | 96 | 3.10% | 62.50% | 0.00% | 34.38% | NA |
| Intermediate | 90 | 47.80% | 12.20% | 4.44% | 35.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0612613334 | A -> G | LOC_Os06g21840.1 | upstream_gene_variant ; 2117.0bp to feature; MODIFIER | silent_mutation | Average:15.54; most accessible tissue: Callus, score: 63.817 | N | N | N | N |
| vg0612613334 | A -> G | LOC_Os06g21830.1 | downstream_gene_variant ; 4016.0bp to feature; MODIFIER | silent_mutation | Average:15.54; most accessible tissue: Callus, score: 63.817 | N | N | N | N |
| vg0612613334 | A -> G | LOC_Os06g21830-LOC_Os06g21840 | intergenic_region ; MODIFIER | silent_mutation | Average:15.54; most accessible tissue: Callus, score: 63.817 | N | N | N | N |
| vg0612613334 | A -> DEL | N | N | silent_mutation | Average:15.54; most accessible tissue: Callus, score: 63.817 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0612613334 | NA | 3.02E-17 | mr1253 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612613334 | 2.48E-06 | NA | mr1070_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612613334 | 7.27E-07 | NA | mr1211_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612613334 | 5.45E-06 | NA | mr1437_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |