\
| Variant ID: vg0612612601 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 12612601 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CCCTCTAAAACCGCATAGCCAGCCCATCTTACGGATGGACCCACTTACGCACACCACTCCAGTTACACTTTCATCCTCGCTTCGTGTAAAAGGGTTAACC[T/G]
GGAGTGGTATGATTGGAGGAATGATGCCTTGTAAGTTGGTTCCACCCTTACTAAACTAGCAAGGTAGTACTAAACATGCATACACAGCTCTTATGGGCCA
TGGCCCATAAGAGCTGTGTATGCATGTTTAGTACTACCTTGCTAGTTTAGTAAGGGTGGAACCAACTTACAAGGCATCATTCCTCCAATCATACCACTCC[A/C]
GGTTAACCCTTTTACACGAAGCGAGGATGAAAGTGTAACTGGAGTGGTGTGCGTAAGTGGGTCCATCCGTAAGATGGGCTGGCTATGCGGTTTTAGAGGG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 63.30% | 33.90% | 1.44% | 1.38% | NA |
| All Indica | 2759 | 93.70% | 4.50% | 1.70% | 0.11% | NA |
| All Japonica | 1512 | 9.60% | 88.90% | 0.40% | 1.12% | NA |
| Aus | 269 | 64.30% | 14.90% | 4.46% | 16.36% | NA |
| Indica I | 595 | 89.10% | 7.20% | 3.70% | 0.00% | NA |
| Indica II | 465 | 94.60% | 4.10% | 1.08% | 0.22% | NA |
| Indica III | 913 | 98.80% | 0.90% | 0.11% | 0.22% | NA |
| Indica Intermediate | 786 | 90.80% | 6.70% | 2.42% | 0.00% | NA |
| Temperate Japonica | 767 | 3.00% | 96.90% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 20.00% | 76.40% | 0.79% | 2.78% | NA |
| Japonica Intermediate | 241 | 8.70% | 89.60% | 0.41% | 1.24% | NA |
| VI/Aromatic | 96 | 40.60% | 58.30% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 52.20% | 44.40% | 2.22% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0612612601 | T -> G | LOC_Os06g21840.1 | upstream_gene_variant ; 2850.0bp to feature; MODIFIER | silent_mutation | Average:29.006; most accessible tissue: Callus, score: 44.937 | N | N | N | N |
| vg0612612601 | T -> G | LOC_Os06g21830.1 | downstream_gene_variant ; 3283.0bp to feature; MODIFIER | silent_mutation | Average:29.006; most accessible tissue: Callus, score: 44.937 | N | N | N | N |
| vg0612612601 | T -> G | LOC_Os06g21830-LOC_Os06g21840 | intergenic_region ; MODIFIER | silent_mutation | Average:29.006; most accessible tissue: Callus, score: 44.937 | N | N | N | N |
| vg0612612601 | T -> DEL | N | N | silent_mutation | Average:29.006; most accessible tissue: Callus, score: 44.937 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0612612601 | NA | 9.91E-06 | mr1104 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612612601 | 5.29E-06 | 5.29E-06 | mr1165 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612612601 | NA | 1.00E-05 | mr1437 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612612601 | NA | 1.12E-20 | mr1477 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612612601 | NA | 1.77E-08 | mr1165_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612612601 | NA | 3.92E-06 | mr1199_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612612601 | NA | 5.18E-06 | mr1264_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612612601 | NA | 2.45E-08 | mr1408_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |