\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0612612601:

Variant ID: vg0612612601 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 12612601
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCCTCTAAAACCGCATAGCCAGCCCATCTTACGGATGGACCCACTTACGCACACCACTCCAGTTACACTTTCATCCTCGCTTCGTGTAAAAGGGTTAACC[T/G]
GGAGTGGTATGATTGGAGGAATGATGCCTTGTAAGTTGGTTCCACCCTTACTAAACTAGCAAGGTAGTACTAAACATGCATACACAGCTCTTATGGGCCA

Reverse complement sequence

TGGCCCATAAGAGCTGTGTATGCATGTTTAGTACTACCTTGCTAGTTTAGTAAGGGTGGAACCAACTTACAAGGCATCATTCCTCCAATCATACCACTCC[A/C]
GGTTAACCCTTTTACACGAAGCGAGGATGAAAGTGTAACTGGAGTGGTGTGCGTAAGTGGGTCCATCCGTAAGATGGGCTGGCTATGCGGTTTTAGAGGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.30% 33.90% 1.44% 1.38% NA
All Indica  2759 93.70% 4.50% 1.70% 0.11% NA
All Japonica  1512 9.60% 88.90% 0.40% 1.12% NA
Aus  269 64.30% 14.90% 4.46% 16.36% NA
Indica I  595 89.10% 7.20% 3.70% 0.00% NA
Indica II  465 94.60% 4.10% 1.08% 0.22% NA
Indica III  913 98.80% 0.90% 0.11% 0.22% NA
Indica Intermediate  786 90.80% 6.70% 2.42% 0.00% NA
Temperate Japonica  767 3.00% 96.90% 0.13% 0.00% NA
Tropical Japonica  504 20.00% 76.40% 0.79% 2.78% NA
Japonica Intermediate  241 8.70% 89.60% 0.41% 1.24% NA
VI/Aromatic  96 40.60% 58.30% 1.04% 0.00% NA
Intermediate  90 52.20% 44.40% 2.22% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0612612601 T -> G LOC_Os06g21840.1 upstream_gene_variant ; 2850.0bp to feature; MODIFIER silent_mutation Average:29.006; most accessible tissue: Callus, score: 44.937 N N N N
vg0612612601 T -> G LOC_Os06g21830.1 downstream_gene_variant ; 3283.0bp to feature; MODIFIER silent_mutation Average:29.006; most accessible tissue: Callus, score: 44.937 N N N N
vg0612612601 T -> G LOC_Os06g21830-LOC_Os06g21840 intergenic_region ; MODIFIER silent_mutation Average:29.006; most accessible tissue: Callus, score: 44.937 N N N N
vg0612612601 T -> DEL N N silent_mutation Average:29.006; most accessible tissue: Callus, score: 44.937 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0612612601 NA 9.91E-06 mr1104 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612612601 5.29E-06 5.29E-06 mr1165 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612612601 NA 1.00E-05 mr1437 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612612601 NA 1.12E-20 mr1477 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612612601 NA 1.77E-08 mr1165_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612612601 NA 3.92E-06 mr1199_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612612601 NA 5.18E-06 mr1264_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612612601 NA 2.45E-08 mr1408_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251