\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0612586822:

Variant ID: vg0612586822 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 12586822
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.98, C: 0.02, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:


AAAGGAATCCATACCACACTTGAGTGAGTTGCTTGGGAGAATTGAGAATCAATATGCAACCCTTGAGAGGCAAGAGGAATTGCTCATTCGTGAGAAAGAG[T/C]
GGTCTCATGAACTCAAGAGTGAACTTTCTAAGGAGAGAGAGAGAAATGAGGCTTTGGTACGGCTTTACAAGCAAACCAAAGAGTCTCATGCTAATCTTGA

Reverse complement sequence

TCAAGATTAGCATGAGACTCTTTGGTTTGCTTGTAAAGCCGTACCAAAGCCTCATTTCTCTCTCTCTCCTTAGAAAGTTCACTCTTGAGTTCATGAGACC[A/G]
CTCTTTCTCACGAATGAGCAATTCCTCTTGCCTCTCAAGGGTTGCATATTGATTCTCAATTCTCCCAAGCAACTCACTCAAGTGTGGTATGGATTCCTTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 37.60% 7.50% 15.85% 39.04% NA
All Indica  2759 9.70% 12.80% 25.81% 51.69% NA
All Japonica  1512 89.60% 0.00% 0.99% 9.39% NA
Aus  269 17.80% 0.00% 2.60% 79.55% NA
Indica I  595 17.10% 32.40% 8.74% 41.68% NA
Indica II  465 9.50% 6.20% 33.12% 51.18% NA
Indica III  913 2.40% 3.40% 32.31% 61.88% NA
Indica Intermediate  786 12.70% 12.70% 26.84% 47.71% NA
Temperate Japonica  767 97.40% 0.00% 0.39% 2.22% NA
Tropical Japonica  504 77.20% 0.00% 1.59% 21.23% NA
Japonica Intermediate  241 90.90% 0.00% 1.66% 7.47% NA
VI/Aromatic  96 60.40% 0.00% 0.00% 39.58% NA
Intermediate  90 53.30% 2.20% 16.67% 27.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0612586822 T -> C LOC_Os06g21780.1 missense_variant ; p.Trp338Arg; MODERATE nonsynonymous_codon ; W338R Average:10.181; most accessible tissue: Callus, score: 41.931 probably damaging -3.033 TOLERATED 1.00
vg0612586822 T -> DEL LOC_Os06g21780.1 N frameshift_variant Average:10.181; most accessible tissue: Callus, score: 41.931 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0612586822 3.75E-06 8.53E-09 mr1033 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612586822 NA 2.24E-28 mr1075 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612586822 NA 7.08E-06 mr1076 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612586822 NA 4.05E-09 mr1082 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612586822 NA 1.62E-06 mr1083 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612586822 NA 4.74E-06 mr1086 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612586822 NA 1.89E-07 mr1103 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612586822 NA 4.10E-07 mr1104 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612586822 NA 3.47E-08 mr1107 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612586822 NA 2.47E-07 mr1145 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612586822 NA 6.97E-07 mr1155 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612586822 NA 1.13E-06 mr1176 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612586822 NA 7.39E-30 mr1202 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612586822 NA 2.63E-10 mr1226 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612586822 NA 7.39E-09 mr1301 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612586822 2.63E-06 3.26E-10 mr1411 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612586822 2.75E-06 9.94E-06 mr1434 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612586822 NA 8.23E-07 mr1436 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612586822 NA 9.85E-06 mr1437 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612586822 NA 9.52E-19 mr1518 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612586822 NA 7.83E-07 mr1518 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612586822 NA 4.52E-20 mr1541 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612586822 NA 3.21E-09 mr1560 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612586822 NA 7.28E-22 mr1588 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612586822 NA 1.60E-06 mr1620 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612586822 NA 1.91E-11 mr1713 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612586822 NA 3.21E-33 mr1733 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612586822 NA 7.13E-30 mr1737 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612586822 5.09E-06 NA mr1033_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251