Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0612586822:

Variant ID: vg0612586822 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 12586822
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.98, C: 0.02, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:

AAAGGAATCCATACCACACTTGAGTGAGTTGCTTGGGAGAATTGAGAATCAATATGCAACCCTTGAGAGGCAAGAGGAATTGCTCATTCGTGAGAAAGAG[T/C]
GGTCTCATGAACTCAAGAGTGAACTTTCTAAGGAGAGAGAGAGAAATGAGGCTTTGGTACGGCTTTACAAGCAAACCAAAGAGTCTCATGCTAATCTTGA

Reverse complement sequence

TCAAGATTAGCATGAGACTCTTTGGTTTGCTTGTAAAGCCGTACCAAAGCCTCATTTCTCTCTCTCTCCTTAGAAAGTTCACTCTTGAGTTCATGAGACC[A/G]
CTCTTTCTCACGAATGAGCAATTCCTCTTGCCTCTCAAGGGTTGCATATTGATTCTCAATTCTCCCAAGCAACTCACTCAAGTGTGGTATGGATTCCTTT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	37.60%	7.50%	15.85%	39.04%	NA
All Indica	2759	9.70%	12.80%	25.81%	51.69%	NA
All Japonica	1512	89.60%	0.00%	0.99%	9.39%	NA
Aus	269	17.80%	0.00%	2.60%	79.55%	NA
Indica I	595	17.10%	32.40%	8.74%	41.68%	NA
Indica II	465	9.50%	6.20%	33.12%	51.18%	NA
Indica III	913	2.40%	3.40%	32.31%	61.88%	NA
Indica Intermediate	786	12.70%	12.70%	26.84%	47.71%	NA
Temperate Japonica	767	97.40%	0.00%	0.39%	2.22%	NA
Tropical Japonica	504	77.20%	0.00%	1.59%	21.23%	NA
Japonica Intermediate	241	90.90%	0.00%	1.66%	7.47%	NA
VI/Aromatic	96	60.40%	0.00%	0.00%	39.58%	NA
Intermediate	90	53.30%	2.20%	16.67%	27.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0612586822	T -> C	LOC_Os06g21780.1	missense_variant ; p.Trp338Arg; MODERATE	nonsynonymous_codon ; W338R	Average:10.181; most accessible tissue: Callus, score: 41.931	probably damaging	-3.033	TOLERATED	1.00
vg0612586822	T -> DEL	LOC_Os06g21780.1	N	frameshift_variant	Average:10.181; most accessible tissue: Callus, score: 41.931	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0612586822	3.75E-06	8.53E-09	mr1033	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612586822	NA	2.24E-28	mr1075	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612586822	NA	7.08E-06	mr1076	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612586822	NA	4.05E-09	mr1082	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612586822	NA	1.62E-06	mr1083	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612586822	NA	4.74E-06	mr1086	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612586822	NA	1.89E-07	mr1103	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612586822	NA	4.10E-07	mr1104	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612586822	NA	3.47E-08	mr1107	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612586822	NA	2.47E-07	mr1145	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612586822	NA	6.97E-07	mr1155	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612586822	NA	1.13E-06	mr1176	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612586822	NA	7.39E-30	mr1202	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612586822	NA	2.63E-10	mr1226	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612586822	NA	7.39E-09	mr1301	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612586822	2.63E-06	3.26E-10	mr1411	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612586822	2.75E-06	9.94E-06	mr1434	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612586822	NA	8.23E-07	mr1436	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612586822	NA	9.85E-06	mr1437	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612586822	NA	9.52E-19	mr1518	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612586822	NA	7.83E-07	mr1518	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612586822	NA	4.52E-20	mr1541	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612586822	NA	3.21E-09	mr1560	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612586822	NA	7.28E-22	mr1588	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612586822	NA	1.60E-06	mr1620	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612586822	NA	1.91E-11	mr1713	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612586822	NA	3.21E-33	mr1733	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612586822	NA	7.13E-30	mr1737	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612586822	5.09E-06	NA	mr1033_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251