\
| Variant ID: vg0612574686 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 12574686 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CGGTCAGGGGCGGATCCAGGAAAAAATAGTAGGTGGGGCTGAACAGACTCTACCCTAGACCTCTTTAGCGGACTTATATTCTCGTGGTTGCGTGGAGGAT[C/T]
ACTGGTATCTGTGTTGTTTGAACTAGAATAATACATAAGCATTATTCTTTTTGGCATGTTGACAAACTAAAAATGTAGAAACAATTATAAATTTTAATCA
TGATTAAAATTTATAATTGTTTCTACATTTTTAGTTTGTCAACATGCCAAAAAGAATAATGCTTATGTATTATTCTAGTTCAAACAACACAGATACCAGT[G/A]
ATCCTCCACGCAACCACGAGAATATAAGTCCGCTAAAGAGGTCTAGGGTAGAGTCTGTTCAGCCCCACCTACTATTTTTTCCTGGATCCGCCCCTGACCG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 43.90% | 2.60% | 3.00% | 50.44% | NA |
| All Indica | 2759 | 22.80% | 0.20% | 2.97% | 74.05% | NA |
| All Japonica | 1512 | 85.80% | 7.20% | 3.37% | 3.64% | NA |
| Aus | 269 | 16.00% | 0.40% | 1.49% | 82.16% | NA |
| Indica I | 595 | 33.30% | 0.00% | 2.02% | 64.71% | NA |
| Indica II | 465 | 11.60% | 0.00% | 3.01% | 85.38% | NA |
| Indica III | 913 | 21.10% | 0.30% | 4.16% | 74.37% | NA |
| Indica Intermediate | 786 | 23.30% | 0.40% | 2.29% | 74.05% | NA |
| Temperate Japonica | 767 | 97.00% | 0.10% | 0.13% | 2.74% | NA |
| Tropical Japonica | 504 | 70.60% | 18.30% | 6.94% | 4.17% | NA |
| Japonica Intermediate | 241 | 81.70% | 6.60% | 6.22% | 5.39% | NA |
| VI/Aromatic | 96 | 60.40% | 3.10% | 2.08% | 34.38% | NA |
| Intermediate | 90 | 56.70% | 4.40% | 3.33% | 35.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0612574686 | C -> T | LOC_Os06g21770.1 | upstream_gene_variant ; 2342.0bp to feature; MODIFIER | silent_mutation | Average:26.789; most accessible tissue: Zhenshan97 flower, score: 63.813 | N | N | N | N |
| vg0612574686 | C -> T | LOC_Os06g21750.1 | downstream_gene_variant ; 3606.0bp to feature; MODIFIER | silent_mutation | Average:26.789; most accessible tissue: Zhenshan97 flower, score: 63.813 | N | N | N | N |
| vg0612574686 | C -> T | LOC_Os06g21760.1 | downstream_gene_variant ; 434.0bp to feature; MODIFIER | silent_mutation | Average:26.789; most accessible tissue: Zhenshan97 flower, score: 63.813 | N | N | N | N |
| vg0612574686 | C -> T | LOC_Os06g21760-LOC_Os06g21770 | intergenic_region ; MODIFIER | silent_mutation | Average:26.789; most accessible tissue: Zhenshan97 flower, score: 63.813 | N | N | N | N |
| vg0612574686 | C -> DEL | N | N | silent_mutation | Average:26.789; most accessible tissue: Zhenshan97 flower, score: 63.813 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0612574686 | 4.01E-07 | 5.99E-07 | mr1117_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612574686 | NA | 8.43E-06 | mr1119_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612574686 | 1.95E-06 | NA | mr1120_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612574686 | 4.69E-06 | NA | mr1123_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612574686 | 3.03E-06 | NA | mr1247_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612574686 | 1.92E-06 | NA | mr1936_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |