\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0612574686:

Variant ID: vg0612574686 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 12574686
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGGTCAGGGGCGGATCCAGGAAAAAATAGTAGGTGGGGCTGAACAGACTCTACCCTAGACCTCTTTAGCGGACTTATATTCTCGTGGTTGCGTGGAGGAT[C/T]
ACTGGTATCTGTGTTGTTTGAACTAGAATAATACATAAGCATTATTCTTTTTGGCATGTTGACAAACTAAAAATGTAGAAACAATTATAAATTTTAATCA

Reverse complement sequence

TGATTAAAATTTATAATTGTTTCTACATTTTTAGTTTGTCAACATGCCAAAAAGAATAATGCTTATGTATTATTCTAGTTCAAACAACACAGATACCAGT[G/A]
ATCCTCCACGCAACCACGAGAATATAAGTCCGCTAAAGAGGTCTAGGGTAGAGTCTGTTCAGCCCCACCTACTATTTTTTCCTGGATCCGCCCCTGACCG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 43.90% 2.60% 3.00% 50.44% NA
All Indica  2759 22.80% 0.20% 2.97% 74.05% NA
All Japonica  1512 85.80% 7.20% 3.37% 3.64% NA
Aus  269 16.00% 0.40% 1.49% 82.16% NA
Indica I  595 33.30% 0.00% 2.02% 64.71% NA
Indica II  465 11.60% 0.00% 3.01% 85.38% NA
Indica III  913 21.10% 0.30% 4.16% 74.37% NA
Indica Intermediate  786 23.30% 0.40% 2.29% 74.05% NA
Temperate Japonica  767 97.00% 0.10% 0.13% 2.74% NA
Tropical Japonica  504 70.60% 18.30% 6.94% 4.17% NA
Japonica Intermediate  241 81.70% 6.60% 6.22% 5.39% NA
VI/Aromatic  96 60.40% 3.10% 2.08% 34.38% NA
Intermediate  90 56.70% 4.40% 3.33% 35.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0612574686 C -> T LOC_Os06g21770.1 upstream_gene_variant ; 2342.0bp to feature; MODIFIER silent_mutation Average:26.789; most accessible tissue: Zhenshan97 flower, score: 63.813 N N N N
vg0612574686 C -> T LOC_Os06g21750.1 downstream_gene_variant ; 3606.0bp to feature; MODIFIER silent_mutation Average:26.789; most accessible tissue: Zhenshan97 flower, score: 63.813 N N N N
vg0612574686 C -> T LOC_Os06g21760.1 downstream_gene_variant ; 434.0bp to feature; MODIFIER silent_mutation Average:26.789; most accessible tissue: Zhenshan97 flower, score: 63.813 N N N N
vg0612574686 C -> T LOC_Os06g21760-LOC_Os06g21770 intergenic_region ; MODIFIER silent_mutation Average:26.789; most accessible tissue: Zhenshan97 flower, score: 63.813 N N N N
vg0612574686 C -> DEL N N silent_mutation Average:26.789; most accessible tissue: Zhenshan97 flower, score: 63.813 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0612574686 4.01E-07 5.99E-07 mr1117_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612574686 NA 8.43E-06 mr1119_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612574686 1.95E-06 NA mr1120_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612574686 4.69E-06 NA mr1123_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612574686 3.03E-06 NA mr1247_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612574686 1.92E-06 NA mr1936_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251