\
| Variant ID: vg0612563052 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 12563052 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, G: 0.01, others allele: 0.00, population size: 86. )
AGAATCCCCCATGATTTCGATAGCACCGGCTTCAACTTCCTTTAGTAACTGCAACCCCTTGAGGACCGCCTCATACTCAGCTTGATTATTAGTCGCATAA[A/G]
GTTTAATAGTATAAGCAAACTCAAAACATGCCCCCCGAGGGGAAATTATAACTAAGCCGATACCACAACCATGAGTACAAACTGACCCATCAAAGAATAA
TTATTCTTTGATGGGTCAGTTTGTACTCATGGTTGTGGTATCGGCTTAGTTATAATTTCCCCTCGGGGGGCATGTTTTGAGTTTGCTTATACTATTAAAC[T/C]
TTATGCGACTAATAATCAAGCTGAGTATGAGGCGGTCCTCAAGGGGTTGCAGTTACTAAAGGAAGTTGAAGCCGGTGCTATCGAAATCATGGGGGATTCT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 39.00% | 34.50% | 16.46% | 9.99% | NA |
| All Indica | 2759 | 57.60% | 5.50% | 25.37% | 11.56% | NA |
| All Japonica | 1512 | 0.90% | 88.70% | 1.52% | 8.86% | NA |
| Aus | 269 | 70.60% | 16.00% | 9.67% | 3.72% | NA |
| Indica I | 595 | 47.20% | 8.90% | 32.94% | 10.92% | NA |
| Indica II | 465 | 62.60% | 4.50% | 26.67% | 6.24% | NA |
| Indica III | 913 | 64.40% | 1.50% | 19.50% | 14.57% | NA |
| Indica Intermediate | 786 | 54.60% | 8.00% | 25.70% | 11.70% | NA |
| Temperate Japonica | 767 | 0.30% | 96.30% | 1.43% | 1.96% | NA |
| Tropical Japonica | 504 | 1.60% | 76.60% | 1.59% | 20.24% | NA |
| Japonica Intermediate | 241 | 1.70% | 89.60% | 1.66% | 7.05% | NA |
| VI/Aromatic | 96 | 27.10% | 58.30% | 10.42% | 4.17% | NA |
| Intermediate | 90 | 28.90% | 44.40% | 21.11% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0612563052 | A -> G | LOC_Os06g21740.1 | missense_variant ; p.Leu1012Pro; MODERATE | nonsynonymous_codon ; L1012P | Average:11.111; most accessible tissue: Callus, score: 44.196 | possibly damaging |
-1.818 |
TOLERATED | 1.00 |
| vg0612563052 | A -> DEL | LOC_Os06g21740.1 | N | frameshift_variant | Average:11.111; most accessible tissue: Callus, score: 44.196 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0612563052 | NA | 6.42E-30 | mr1072 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612563052 | NA | 2.08E-06 | mr1072 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612563052 | NA | 5.75E-29 | mr1075 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612563052 | 2.75E-07 | NA | mr1100 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612563052 | 4.78E-08 | 1.63E-08 | mr1100 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612563052 | NA | 3.05E-31 | mr1202 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612563052 | NA | 4.58E-07 | mr1202 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612563052 | NA | 1.11E-06 | mr1395 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612563052 | NA | 5.07E-06 | mr1426 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612563052 | NA | 1.96E-51 | mr1795 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612563052 | NA | 4.27E-54 | mr1861 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612563052 | 5.54E-06 | 7.52E-07 | mr1861 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612563052 | NA | 2.40E-23 | mr1888 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612563052 | NA | 6.32E-15 | mr1933 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612563052 | NA | 1.58E-09 | mr1222_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |