Variant ID: vg0612544928 (JBrowse) | Variation Type: SNP |
Chromosome: chr06 | Position: 12544928 |
Reference Allele: T | Alternative Allele: C |
Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.01, others allele: 0.00, population size: 86. )
TTAATTATTTCATCGAATTTAAGGTAGCATTGCCTTGACGCTTGTTTAAGTCCATAGATAGATTTCTTAAGTTTGCAAGCCAAATGGTCCTTGCCTTCCA[T/C]
AACAAAACCCTCGGGTTGTGCCATGTATACATCCTCATGCAAGTCACCATTAAGAAATGCGGTCTTTACATCCATCTGATGGAGCTCTAAATCATAATGA
TCATTATGATTTAGAGCTCCATCAGATGGATGTAAAGACCGCATTTCTTAATGGTGACTTGCATGAGGATGTATACATGGCACAACCCGAGGGTTTTGTT[A/G]
TGGAAGGCAAGGACCATTTGGCTTGCAAACTTAAGAAATCTATCTATGGACTTAAACAAGCGTCAAGGCAATGCTACCTTAAATTCGATGAAATAATTAA
Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 66.10% | 25.80% | 8.13% | 0.00% | NA |
All Indica | 2759 | 44.80% | 42.10% | 13.12% | 0.00% | NA |
All Japonica | 1512 | 98.70% | 0.80% | 0.46% | 0.00% | NA |
Aus | 269 | 86.60% | 9.70% | 3.72% | 0.00% | NA |
Indica I | 595 | 73.90% | 12.80% | 13.28% | 0.00% | NA |
Indica II | 465 | 70.80% | 17.80% | 11.40% | 0.00% | NA |
Indica III | 913 | 15.10% | 72.60% | 12.27% | 0.00% | NA |
Indica Intermediate | 786 | 41.70% | 43.30% | 15.01% | 0.00% | NA |
Temperate Japonica | 767 | 99.20% | 0.70% | 0.13% | 0.00% | NA |
Tropical Japonica | 504 | 98.20% | 1.20% | 0.60% | 0.00% | NA |
Japonica Intermediate | 241 | 98.30% | 0.40% | 1.24% | 0.00% | NA |
VI/Aromatic | 96 | 95.80% | 1.00% | 3.12% | 0.00% | NA |
Intermediate | 90 | 78.90% | 18.90% | 2.22% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0612544928 | T -> C | LOC_Os06g21700.1 | missense_variant ; p.Met396Val; MODERATE | nonsynonymous_codon ; M396V | Average:8.639; most accessible tissue: Callus, score: 14.86 | benign | -0.367 | TOLERATED | 0.33 |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0612544928 | 3.43E-09 | 7.60E-21 | mr1133 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0612544928 | 1.17E-09 | 2.29E-15 | mr1133 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0612544928 | 1.66E-06 | 1.59E-12 | mr1667 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0612544928 | 1.43E-06 | 3.09E-10 | mr1667 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0612544928 | 4.71E-09 | 5.93E-22 | mr1133_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0612544928 | 1.03E-07 | 1.18E-14 | mr1133_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0612544928 | NA | 2.06E-12 | mr1667_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0612544928 | 3.85E-06 | 2.72E-10 | mr1667_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |