Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0612544297:

Variant ID: vg0612544297 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 12544297
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AGTGTCTACACAACCTGCAAAGTCCGCGTCTGAATAACCTAGGACTTCAAGTTCTTCAGATTTCTTATATGTGAGCATGTAATCCTTAGTGCCTTACAAA[T/A]
AACGCAAGACCTTTTTAACAGCCTTCCAGTGATCTAAACCTGGATTGGACTAAAATCTACCAAGCATCCCGATAACAAATGCTAAGTCTGGACGCGTACA

Reverse complement sequence

TGTACGCGTCCAGACTTAGCATTTGTTATCGGGATGCTTGGTAGATTTTAGTCCAATCCAGGTTTAGATCACTGGAAGGCTGTTAAAAAGGTCTTGCGTT[A/T]
TTTGTAAGGCACTAAGGATTACATGCTCACATATAAGAAATCTGAAGAACTTGAAGTCCTAGGTTATTCAGACGCGGACTTTGCAGGTTGTGTAGACACT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	91.50%	0.80%	5.31%	2.48%	NA
All Indica	2759	90.20%	0.00%	6.09%	3.70%	NA
All Japonica	1512	92.30%	2.40%	4.63%	0.73%	NA
Aus	269	97.80%	0.00%	1.86%	0.37%	NA
Indica I	595	84.50%	0.00%	10.59%	4.87%	NA
Indica II	465	84.70%	0.00%	7.10%	8.17%	NA
Indica III	913	95.90%	0.00%	3.50%	0.55%	NA
Indica Intermediate	786	91.10%	0.00%	5.09%	3.82%	NA
Temperate Japonica	767	90.50%	4.70%	4.04%	0.78%	NA
Tropical Japonica	504	93.10%	0.00%	6.35%	0.60%	NA
Japonica Intermediate	241	96.30%	0.00%	2.90%	0.83%	NA
VI/Aromatic	96	97.90%	0.00%	2.08%	0.00%	NA
Intermediate	90	90.00%	0.00%	6.67%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0612544297	T -> A	LOC_Os06g21700.1	intron_variant ; MODIFIER	silent_mutation	Average:8.907; most accessible tissue: Callus, score: 49.013	N	N	N	N
vg0612544297	T -> DEL	N	N	silent_mutation	Average:8.907; most accessible tissue: Callus, score: 49.013	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0612544297	2.99E-07	2.99E-07	mr1343	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612544297	NA	6.94E-08	mr1354	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612544297	NA	9.37E-08	mr1829	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612544297	NA	1.48E-06	mr1902	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612544297	NA	2.66E-09	mr1354_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612544297	NA	5.52E-06	mr1549_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612544297	NA	3.70E-07	mr1757_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612544297	NA	1.27E-06	mr1829_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612544297	NA	7.07E-08	mr1902_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251