\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0612544297:

Variant ID: vg0612544297 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 12544297
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGTGTCTACACAACCTGCAAAGTCCGCGTCTGAATAACCTAGGACTTCAAGTTCTTCAGATTTCTTATATGTGAGCATGTAATCCTTAGTGCCTTACAAA[T/A]
AACGCAAGACCTTTTTAACAGCCTTCCAGTGATCTAAACCTGGATTGGACTAAAATCTACCAAGCATCCCGATAACAAATGCTAAGTCTGGACGCGTACA

Reverse complement sequence

TGTACGCGTCCAGACTTAGCATTTGTTATCGGGATGCTTGGTAGATTTTAGTCCAATCCAGGTTTAGATCACTGGAAGGCTGTTAAAAAGGTCTTGCGTT[A/T]
TTTGTAAGGCACTAAGGATTACATGCTCACATATAAGAAATCTGAAGAACTTGAAGTCCTAGGTTATTCAGACGCGGACTTTGCAGGTTGTGTAGACACT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.50% 0.80% 5.31% 2.48% NA
All Indica  2759 90.20% 0.00% 6.09% 3.70% NA
All Japonica  1512 92.30% 2.40% 4.63% 0.73% NA
Aus  269 97.80% 0.00% 1.86% 0.37% NA
Indica I  595 84.50% 0.00% 10.59% 4.87% NA
Indica II  465 84.70% 0.00% 7.10% 8.17% NA
Indica III  913 95.90% 0.00% 3.50% 0.55% NA
Indica Intermediate  786 91.10% 0.00% 5.09% 3.82% NA
Temperate Japonica  767 90.50% 4.70% 4.04% 0.78% NA
Tropical Japonica  504 93.10% 0.00% 6.35% 0.60% NA
Japonica Intermediate  241 96.30% 0.00% 2.90% 0.83% NA
VI/Aromatic  96 97.90% 0.00% 2.08% 0.00% NA
Intermediate  90 90.00% 0.00% 6.67% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0612544297 T -> A LOC_Os06g21700.1 intron_variant ; MODIFIER silent_mutation Average:8.907; most accessible tissue: Callus, score: 49.013 N N N N
vg0612544297 T -> DEL N N silent_mutation Average:8.907; most accessible tissue: Callus, score: 49.013 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0612544297 2.99E-07 2.99E-07 mr1343 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612544297 NA 6.94E-08 mr1354 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612544297 NA 9.37E-08 mr1829 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612544297 NA 1.48E-06 mr1902 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612544297 NA 2.66E-09 mr1354_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612544297 NA 5.52E-06 mr1549_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612544297 NA 3.70E-07 mr1757_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612544297 NA 1.27E-06 mr1829_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612544297 NA 7.07E-08 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251