| Variant ID: vg0612544297 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 12544297 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AGTGTCTACACAACCTGCAAAGTCCGCGTCTGAATAACCTAGGACTTCAAGTTCTTCAGATTTCTTATATGTGAGCATGTAATCCTTAGTGCCTTACAAA[T/A]
AACGCAAGACCTTTTTAACAGCCTTCCAGTGATCTAAACCTGGATTGGACTAAAATCTACCAAGCATCCCGATAACAAATGCTAAGTCTGGACGCGTACA
TGTACGCGTCCAGACTTAGCATTTGTTATCGGGATGCTTGGTAGATTTTAGTCCAATCCAGGTTTAGATCACTGGAAGGCTGTTAAAAAGGTCTTGCGTT[A/T]
TTTGTAAGGCACTAAGGATTACATGCTCACATATAAGAAATCTGAAGAACTTGAAGTCCTAGGTTATTCAGACGCGGACTTTGCAGGTTGTGTAGACACT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.50% | 0.80% | 5.31% | 2.48% | NA |
| All Indica | 2759 | 90.20% | 0.00% | 6.09% | 3.70% | NA |
| All Japonica | 1512 | 92.30% | 2.40% | 4.63% | 0.73% | NA |
| Aus | 269 | 97.80% | 0.00% | 1.86% | 0.37% | NA |
| Indica I | 595 | 84.50% | 0.00% | 10.59% | 4.87% | NA |
| Indica II | 465 | 84.70% | 0.00% | 7.10% | 8.17% | NA |
| Indica III | 913 | 95.90% | 0.00% | 3.50% | 0.55% | NA |
| Indica Intermediate | 786 | 91.10% | 0.00% | 5.09% | 3.82% | NA |
| Temperate Japonica | 767 | 90.50% | 4.70% | 4.04% | 0.78% | NA |
| Tropical Japonica | 504 | 93.10% | 0.00% | 6.35% | 0.60% | NA |
| Japonica Intermediate | 241 | 96.30% | 0.00% | 2.90% | 0.83% | NA |
| VI/Aromatic | 96 | 97.90% | 0.00% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 90.00% | 0.00% | 6.67% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0612544297 | T -> A | LOC_Os06g21700.1 | intron_variant ; MODIFIER | silent_mutation | Average:8.907; most accessible tissue: Callus, score: 49.013 | N | N | N | N |
| vg0612544297 | T -> DEL | N | N | silent_mutation | Average:8.907; most accessible tissue: Callus, score: 49.013 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0612544297 | 2.99E-07 | 2.99E-07 | mr1343 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612544297 | NA | 6.94E-08 | mr1354 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612544297 | NA | 9.37E-08 | mr1829 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612544297 | NA | 1.48E-06 | mr1902 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612544297 | NA | 2.66E-09 | mr1354_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612544297 | NA | 5.52E-06 | mr1549_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612544297 | NA | 3.70E-07 | mr1757_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612544297 | NA | 1.27E-06 | mr1829_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612544297 | NA | 7.07E-08 | mr1902_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |