\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0612328142:

Variant ID: vg0612328142 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 12328142
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


AGCCTAAGCTGATAGGGAAAGGCGGGCAATTCACTTTATACACTCCAACACTCTCCCTCATGTGAGACCCCCTCAAGTCTCAAGCGTGGAATATTGGAGT[G/T]
GGCTGCAATTATTTTATTTAATTGCGTGCCAGCCAGGATTCGAACTCGAGACCTCTGGCTCTGATACCATATTAATTGCATGCACCAGCCAGTTACACTT

Reverse complement sequence

AAGTGTAACTGGCTGGTGCATGCAATTAATATGGTATCAGAGCCAGAGGTCTCGAGTTCGAATCCTGGCTGGCACGCAATTAAATAAAATAATTGCAGCC[C/A]
ACTCCAATATTCCACGCTTGAGACTTGAGGGGGTCTCACATGAGGGAGAGTGTTGGAGTGTATAAAGTGAATTGCCCGCCTTTCCCTATCAGCTTAGGCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.40% 4.60% 0.00% 0.00% NA
All Indica  2759 92.60% 7.40% 0.00% 0.00% NA
All Japonica  1512 99.50% 0.50% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 90.80% 9.20% 0.00% 0.00% NA
Indica III  913 87.70% 12.30% 0.00% 0.00% NA
Indica Intermediate  786 93.60% 6.40% 0.00% 0.00% NA
Temperate Japonica  767 99.00% 1.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 93.30% 6.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0612328142 G -> T LOC_Os06g21340.1 upstream_gene_variant ; 2059.0bp to feature; MODIFIER silent_mutation Average:57.073; most accessible tissue: Minghui63 root, score: 77.009 N N N N
vg0612328142 G -> T LOC_Os06g21340.3 upstream_gene_variant ; 2653.0bp to feature; MODIFIER silent_mutation Average:57.073; most accessible tissue: Minghui63 root, score: 77.009 N N N N
vg0612328142 G -> T LOC_Os06g21340.2 upstream_gene_variant ; 2059.0bp to feature; MODIFIER silent_mutation Average:57.073; most accessible tissue: Minghui63 root, score: 77.009 N N N N
vg0612328142 G -> T LOC_Os06g21340-LOC_Os06g21360 intergenic_region ; MODIFIER silent_mutation Average:57.073; most accessible tissue: Minghui63 root, score: 77.009 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0612328142 2.69E-06 NA mr1068 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612328142 2.22E-07 1.67E-08 mr1090 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612328142 4.78E-06 NA mr1111 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612328142 8.11E-07 3.84E-07 mr1121 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612328142 2.82E-07 1.57E-08 mr1211 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612328142 1.80E-08 NA mr1068_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612328142 6.61E-10 4.13E-09 mr1090_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612328142 2.32E-06 NA mr1111_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612328142 5.04E-08 1.73E-07 mr1121_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612328142 2.84E-06 NA mr1144_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612328142 4.67E-06 NA mr1200_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612328142 2.13E-09 3.28E-10 mr1211_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251