\
| Variant ID: vg0612328142 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 12328142 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 259. )
AGCCTAAGCTGATAGGGAAAGGCGGGCAATTCACTTTATACACTCCAACACTCTCCCTCATGTGAGACCCCCTCAAGTCTCAAGCGTGGAATATTGGAGT[G/T]
GGCTGCAATTATTTTATTTAATTGCGTGCCAGCCAGGATTCGAACTCGAGACCTCTGGCTCTGATACCATATTAATTGCATGCACCAGCCAGTTACACTT
AAGTGTAACTGGCTGGTGCATGCAATTAATATGGTATCAGAGCCAGAGGTCTCGAGTTCGAATCCTGGCTGGCACGCAATTAAATAAAATAATTGCAGCC[C/A]
ACTCCAATATTCCACGCTTGAGACTTGAGGGGGTCTCACATGAGGGAGAGTGTTGGAGTGTATAAAGTGAATTGCCCGCCTTTCCCTATCAGCTTAGGCT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.40% | 4.60% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 92.60% | 7.40% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 90.80% | 9.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 87.70% | 12.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 93.60% | 6.40% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0612328142 | G -> T | LOC_Os06g21340.1 | upstream_gene_variant ; 2059.0bp to feature; MODIFIER | silent_mutation | Average:57.073; most accessible tissue: Minghui63 root, score: 77.009 | N | N | N | N |
| vg0612328142 | G -> T | LOC_Os06g21340.3 | upstream_gene_variant ; 2653.0bp to feature; MODIFIER | silent_mutation | Average:57.073; most accessible tissue: Minghui63 root, score: 77.009 | N | N | N | N |
| vg0612328142 | G -> T | LOC_Os06g21340.2 | upstream_gene_variant ; 2059.0bp to feature; MODIFIER | silent_mutation | Average:57.073; most accessible tissue: Minghui63 root, score: 77.009 | N | N | N | N |
| vg0612328142 | G -> T | LOC_Os06g21340-LOC_Os06g21360 | intergenic_region ; MODIFIER | silent_mutation | Average:57.073; most accessible tissue: Minghui63 root, score: 77.009 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0612328142 | 2.69E-06 | NA | mr1068 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612328142 | 2.22E-07 | 1.67E-08 | mr1090 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612328142 | 4.78E-06 | NA | mr1111 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612328142 | 8.11E-07 | 3.84E-07 | mr1121 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612328142 | 2.82E-07 | 1.57E-08 | mr1211 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612328142 | 1.80E-08 | NA | mr1068_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612328142 | 6.61E-10 | 4.13E-09 | mr1090_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612328142 | 2.32E-06 | NA | mr1111_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612328142 | 5.04E-08 | 1.73E-07 | mr1121_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612328142 | 2.84E-06 | NA | mr1144_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612328142 | 4.67E-06 | NA | mr1200_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612328142 | 2.13E-09 | 3.28E-10 | mr1211_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |