Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0612255863:

Variant ID: vg0612255863 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 12255863
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:


TACATTATAATTAAAAATGTTAATGAATATCATTTCTTAGTTTTGGACCGAAACGTTATTCCTTCCTTTCCTTTTCTACCCTAGCCCAGTTCAATACCTC[C/T]
CTACGCTCGGCATGTATCTCTTCAGCCCAACACACAAACGGACCCAAGTCACAAGCTCAAGTGGAGTCGTAGGCCCAACTCACATTGCCTTGTTGGATGT

Reverse complement sequence

ACATCCAACAAGGCAATGTGAGTTGGGCCTACGACTCCACTTGAGCTTGTGACTTGGGTCCGTTTGTGTGTTGGGCTGAAGAGATACATGCCGAGCGTAG[G/A]
GAGGTATTGAACTGGGCTAGGGTAGAAAAGGAAAGGAAGGAATAACGTTTCGGTCCAAAACTAAGAAATGATATTCATTAACATTTTTAATTATAATGTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.30% 6.70% 0.06% 0.00% NA
All Indica  2759 92.20% 7.70% 0.11% 0.00% NA
All Japonica  1512 99.40% 0.60% 0.00% 0.00% NA
Aus  269 97.40% 2.60% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 90.80% 9.00% 0.22% 0.00% NA
Indica III  913 87.20% 12.70% 0.11% 0.00% NA
Indica Intermediate  786 93.00% 6.90% 0.13% 0.00% NA
Temperate Japonica  767 99.00% 1.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 25.00% 75.00% 0.00% 0.00% NA
Intermediate  90 83.30% 16.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0612255863 C -> T LOC_Os06g21210.1 upstream_gene_variant ; 2493.0bp to feature; MODIFIER silent_mutation Average:45.898; most accessible tissue: Zhenshan97 young leaf, score: 72.747 N N N N
vg0612255863 C -> T LOC_Os06g21200.1 downstream_gene_variant ; 4911.0bp to feature; MODIFIER silent_mutation Average:45.898; most accessible tissue: Zhenshan97 young leaf, score: 72.747 N N N N
vg0612255863 C -> T LOC_Os06g21210-LOC_Os06g21220 intergenic_region ; MODIFIER silent_mutation Average:45.898; most accessible tissue: Zhenshan97 young leaf, score: 72.747 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0612255863 6.74E-06 NA mr1068 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612255863 3.65E-06 NA mr1090 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612255863 1.62E-07 5.78E-09 mr1090 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612255863 4.58E-06 NA mr1096 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612255863 2.59E-06 NA mr1111 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612255863 1.38E-06 NA mr1111 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612255863 1.21E-06 NA mr1121 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612255863 6.60E-07 3.78E-07 mr1121 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612255863 6.57E-06 NA mr1211 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612255863 1.65E-07 6.51E-09 mr1211 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612255863 NA 2.70E-08 mr1570 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612255863 4.19E-06 NA mr1068_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612255863 3.01E-08 NA mr1068_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612255863 3.63E-06 NA mr1090_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612255863 1.01E-10 1.11E-09 mr1090_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612255863 1.80E-06 NA mr1094_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612255863 5.33E-07 NA mr1094_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612255863 4.21E-06 NA mr1096_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612255863 2.22E-06 NA mr1096_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612255863 9.41E-08 NA mr1111_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612255863 3.30E-07 NA mr1121_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612255863 1.69E-08 7.79E-08 mr1121_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612255863 6.38E-08 NA mr1144_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612255863 3.34E-06 NA mr1200_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612255863 9.04E-06 NA mr1211_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612255863 4.60E-10 9.48E-11 mr1211_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612255863 NA 4.89E-06 mr1400_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251