\
| Variant ID: vg0612211443 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 12211443 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 123. )
TGTCATACAACATTACAAAACATTTTACTCTATCTAATCTAAAATAAGTATAATTCTATATTCAAATATTTTTTACCAGAATAAATGCTATAGTACTATT[G/A]
GTCCTATCAATCACATCCCATATTCCCATCAATTTTCTCCCCATCTCTCAATCACCTATCCTCTCACTCACAACTATCCTTCGTTCAATAGAGGGCATAT
ATATGCCCTCTATTGAACGAAGGATAGTTGTGAGTGAGAGGATAGGTGATTGAGAGATGGGGAGAAAATTGATGGGAATATGGGATGTGATTGATAGGAC[C/T]
AATAGTACTATAGCATTTATTCTGGTAAAAAATATTTGAATATAGAATTATACTTATTTTAGATTAGATAGAGTAAAATGTTTTGTAATGTTGTATGACA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.60% | 6.00% | 3.39% | 0.00% | NA |
| All Indica | 2759 | 84.50% | 9.90% | 5.65% | 0.00% | NA |
| All Japonica | 1512 | 99.60% | 0.20% | 0.20% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 89.20% | 0.70% | 10.08% | 0.00% | NA |
| Indica II | 465 | 48.00% | 40.40% | 11.61% | 0.00% | NA |
| Indica III | 913 | 99.50% | 0.30% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 85.00% | 9.90% | 5.09% | 0.00% | NA |
| Temperate Japonica | 767 | 99.50% | 0.30% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.00% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 7.80% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0612211443 | G -> A | LOC_Os06g21130.1 | upstream_gene_variant ; 2596.0bp to feature; MODIFIER | silent_mutation | Average:42.194; most accessible tissue: Callus, score: 78.779 | N | N | N | N |
| vg0612211443 | G -> A | LOC_Os06g21140.1 | upstream_gene_variant ; 778.0bp to feature; MODIFIER | silent_mutation | Average:42.194; most accessible tissue: Callus, score: 78.779 | N | N | N | N |
| vg0612211443 | G -> A | LOC_Os06g21130-LOC_Os06g21140 | intergenic_region ; MODIFIER | silent_mutation | Average:42.194; most accessible tissue: Callus, score: 78.779 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0612211443 | NA | 4.97E-06 | mr1050 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612211443 | NA | 4.67E-06 | mr1074 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612211443 | NA | 8.36E-27 | mr1877 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612211443 | NA | 1.59E-14 | mr1877 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612211443 | NA | 2.36E-06 | mr1918 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612211443 | NA | 1.75E-09 | mr1929 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612211443 | NA | 7.98E-06 | mr1929 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612211443 | 3.15E-06 | NA | mr1877_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612211443 | NA | 5.25E-08 | mr1877_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |