Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0612211443:

Variant ID: vg0612211443 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 12211443
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 123. )

Flanking Sequence (100 bp) in Reference Genome:

TGTCATACAACATTACAAAACATTTTACTCTATCTAATCTAAAATAAGTATAATTCTATATTCAAATATTTTTTACCAGAATAAATGCTATAGTACTATT[G/A]
GTCCTATCAATCACATCCCATATTCCCATCAATTTTCTCCCCATCTCTCAATCACCTATCCTCTCACTCACAACTATCCTTCGTTCAATAGAGGGCATAT

Reverse complement sequence

ATATGCCCTCTATTGAACGAAGGATAGTTGTGAGTGAGAGGATAGGTGATTGAGAGATGGGGAGAAAATTGATGGGAATATGGGATGTGATTGATAGGAC[C/T]
AATAGTACTATAGCATTTATTCTGGTAAAAAATATTTGAATATAGAATTATACTTATTTTAGATTAGATAGAGTAAAATGTTTTGTAATGTTGTATGACA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.60%	6.00%	3.39%	0.00%	NA
All Indica	2759	84.50%	9.90%	5.65%	0.00%	NA
All Japonica	1512	99.60%	0.20%	0.20%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	89.20%	0.70%	10.08%	0.00%	NA
Indica II	465	48.00%	40.40%	11.61%	0.00%	NA
Indica III	913	99.50%	0.30%	0.22%	0.00%	NA
Indica Intermediate	786	85.00%	9.90%	5.09%	0.00%	NA
Temperate Japonica	767	99.50%	0.30%	0.26%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.00%	0.41%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	91.10%	7.80%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0612211443	G -> A	LOC_Os06g21130.1	upstream_gene_variant ; 2596.0bp to feature; MODIFIER	silent_mutation	Average:42.194; most accessible tissue: Callus, score: 78.779	N	N	N	N
vg0612211443	G -> A	LOC_Os06g21140.1	upstream_gene_variant ; 778.0bp to feature; MODIFIER	silent_mutation	Average:42.194; most accessible tissue: Callus, score: 78.779	N	N	N	N
vg0612211443	G -> A	LOC_Os06g21130-LOC_Os06g21140	intergenic_region ; MODIFIER	silent_mutation	Average:42.194; most accessible tissue: Callus, score: 78.779	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0612211443	NA	4.97E-06	mr1050	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612211443	NA	4.67E-06	mr1074	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612211443	NA	8.36E-27	mr1877	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612211443	NA	1.59E-14	mr1877	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612211443	NA	2.36E-06	mr1918	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612211443	NA	1.75E-09	mr1929	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612211443	NA	7.98E-06	mr1929	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612211443	3.15E-06	NA	mr1877_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612211443	NA	5.25E-08	mr1877_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251