Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0612211443:

Variant ID: vg0612211443 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 12211443
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 123. )

Flanking Sequence (100 bp) in Reference Genome:


TGTCATACAACATTACAAAACATTTTACTCTATCTAATCTAAAATAAGTATAATTCTATATTCAAATATTTTTTACCAGAATAAATGCTATAGTACTATT[G/A]
GTCCTATCAATCACATCCCATATTCCCATCAATTTTCTCCCCATCTCTCAATCACCTATCCTCTCACTCACAACTATCCTTCGTTCAATAGAGGGCATAT

Reverse complement sequence

ATATGCCCTCTATTGAACGAAGGATAGTTGTGAGTGAGAGGATAGGTGATTGAGAGATGGGGAGAAAATTGATGGGAATATGGGATGTGATTGATAGGAC[C/T]
AATAGTACTATAGCATTTATTCTGGTAAAAAATATTTGAATATAGAATTATACTTATTTTAGATTAGATAGAGTAAAATGTTTTGTAATGTTGTATGACA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.60% 6.00% 3.39% 0.00% NA
All Indica  2759 84.50% 9.90% 5.65% 0.00% NA
All Japonica  1512 99.60% 0.20% 0.20% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 89.20% 0.70% 10.08% 0.00% NA
Indica II  465 48.00% 40.40% 11.61% 0.00% NA
Indica III  913 99.50% 0.30% 0.22% 0.00% NA
Indica Intermediate  786 85.00% 9.90% 5.09% 0.00% NA
Temperate Japonica  767 99.50% 0.30% 0.26% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.00% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 91.10% 7.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0612211443 G -> A LOC_Os06g21130.1 upstream_gene_variant ; 2596.0bp to feature; MODIFIER silent_mutation Average:42.194; most accessible tissue: Callus, score: 78.779 N N N N
vg0612211443 G -> A LOC_Os06g21140.1 upstream_gene_variant ; 778.0bp to feature; MODIFIER silent_mutation Average:42.194; most accessible tissue: Callus, score: 78.779 N N N N
vg0612211443 G -> A LOC_Os06g21130-LOC_Os06g21140 intergenic_region ; MODIFIER silent_mutation Average:42.194; most accessible tissue: Callus, score: 78.779 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0612211443 NA 4.97E-06 mr1050 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612211443 NA 4.67E-06 mr1074 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612211443 NA 8.36E-27 mr1877 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612211443 NA 1.59E-14 mr1877 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612211443 NA 2.36E-06 mr1918 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612211443 NA 1.75E-09 mr1929 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612211443 NA 7.98E-06 mr1929 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612211443 3.15E-06 NA mr1877_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612211443 NA 5.25E-08 mr1877_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251