\
| Variant ID: vg0612205203 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 12205203 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 123. )
TCTCCCCCTTTTTAAAAGAAAGAAATTCCCAATTGAACATTCCCAATTGAACCAAAAACATGCTCTCCAAAAACTCTTCTTTTCTTCCCCTTTTGACAAT[G/T]
ATTTCATCAAACATAGGAATTATGTTCATTAAAGTATAAGAGCTTAGCATACATATAGCATATCATGTCATGTGTTGCAATAAAAAGAAAATGAACCCAT
ATGGGTTCATTTTCTTTTTATTGCAACACATGACATGATATGCTATATGTATGCTAAGCTCTTATACTTTAATGAACATAATTCCTATGTTTGATGAAAT[C/A]
ATTGTCAAAAGGGGAAGAAAAGAAGAGTTTTTGGAGAGCATGTTTTTGGTTCAATTGGGAATGTTCAATTGGGAATTTCTTTCTTTTAAAAAGGGGGAGA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.50% | 4.50% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 92.80% | 7.20% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 91.20% | 8.80% | 0.00% | 0.00% | NA |
| Indica III | 913 | 88.10% | 11.90% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 93.60% | 6.40% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0612205203 | G -> T | LOC_Os06g21130.1 | downstream_gene_variant ; 2262.0bp to feature; MODIFIER | silent_mutation | Average:19.206; most accessible tissue: Callus, score: 33.265 | N | N | N | N |
| vg0612205203 | G -> T | LOC_Os06g21120.1 | downstream_gene_variant ; 4541.0bp to feature; MODIFIER | silent_mutation | Average:19.206; most accessible tissue: Callus, score: 33.265 | N | N | N | N |
| vg0612205203 | G -> T | LOC_Os06g21120-LOC_Os06g21130 | intergenic_region ; MODIFIER | silent_mutation | Average:19.206; most accessible tissue: Callus, score: 33.265 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0612205203 | 6.92E-06 | NA | mr1068 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612205203 | 1.77E-07 | 4.02E-09 | mr1090 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612205203 | 2.82E-06 | NA | mr1111 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612205203 | 7.93E-07 | 4.19E-07 | mr1121 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612205203 | 7.57E-08 | 2.21E-09 | mr1211 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612205203 | 3.71E-07 | NA | mr1068_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612205203 | 2.90E-09 | 4.44E-09 | mr1090_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612205203 | 2.90E-07 | NA | mr1094_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612205203 | 4.82E-06 | NA | mr1096_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612205203 | 9.38E-07 | NA | mr1111_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612205203 | 6.36E-08 | 1.51E-07 | mr1121_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612205203 | 5.93E-07 | NA | mr1144_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612205203 | 1.51E-08 | 6.25E-10 | mr1211_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |