\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0612179300:

Variant ID: vg0612179300 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 12179300
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 128. )

Flanking Sequence (100 bp) in Reference Genome:


TAAAGGTTAGTAGTCATCTGTGACGGGCTCTAGTTGTGGCCCGATAGAGATAGGTCATCTGTGACGGGCTATAGTTTGACTGGTCGTCTGGGTCAAAGCT[A/C]
TTTTTGACGGGCTTTACTTAGGGCCCGATTGAGATATATTCATTCGTGACGGCTATTTGCCCGATTGAAATGACTCTTCACATCAGTGACTTCTAGCCTG

Reverse complement sequence

CAGGCTAGAAGTCACTGATGTGAAGAGTCATTTCAATCGGGCAAATAGCCGTCACGAATGAATATATCTCAATCGGGCCCTAAGTAAAGCCCGTCAAAAA[T/G]
AGCTTTGACCCAGACGACCAGTCAAACTATAGCCCGTCACAGATGACCTATCTCTATCGGGCCACAACTAGAGCCCGTCACAGATGACTACTAACCTTTA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.80% 1.30% 3.70% 3.20% NA
All Indica  2759 87.00% 2.20% 5.58% 5.22% NA
All Japonica  1512 98.50% 0.00% 1.19% 0.33% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 80.70% 6.60% 9.24% 3.53% NA
Indica II  465 83.70% 0.40% 6.67% 9.25% NA
Indica III  913 93.20% 0.00% 2.41% 4.38% NA
Indica Intermediate  786 86.60% 2.40% 5.85% 5.09% NA
Temperate Japonica  767 99.70% 0.00% 0.00% 0.26% NA
Tropical Japonica  504 96.00% 0.00% 3.57% 0.40% NA
Japonica Intermediate  241 99.60% 0.00% 0.00% 0.41% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 94.40% 0.00% 3.33% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0612179300 A -> C LOC_Os06g21068.1 upstream_gene_variant ; 4048.0bp to feature; MODIFIER silent_mutation Average:48.95; most accessible tissue: Zhenshan97 root, score: 70.081 N N N N
vg0612179300 A -> C LOC_Os06g21080.1 downstream_gene_variant ; 692.0bp to feature; MODIFIER silent_mutation Average:48.95; most accessible tissue: Zhenshan97 root, score: 70.081 N N N N
vg0612179300 A -> C LOC_Os06g21080-LOC_Os06g21090 intergenic_region ; MODIFIER silent_mutation Average:48.95; most accessible tissue: Zhenshan97 root, score: 70.081 N N N N
vg0612179300 A -> DEL N N silent_mutation Average:48.95; most accessible tissue: Zhenshan97 root, score: 70.081 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0612179300 NA 9.27E-11 Heading_date Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0612179300 NA 7.95E-06 mr1125 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612179300 NA 1.64E-06 mr1389 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612179300 NA 9.91E-08 mr1038_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612179300 NA 5.52E-07 mr1156_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612179300 NA 8.40E-07 mr1159_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612179300 NA 1.74E-06 mr1186_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612179300 8.74E-06 3.53E-06 mr1245_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612179300 8.66E-06 8.66E-06 mr1284_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612179300 NA 2.12E-06 mr1349_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612179300 NA 4.94E-07 mr1389_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612179300 NA 2.94E-06 mr1616_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612179300 NA 4.85E-06 mr1648_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612179300 3.70E-06 3.69E-06 mr1651_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612179300 9.93E-06 3.88E-06 mr1655_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612179300 NA 1.04E-07 mr1669_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612179300 NA 4.88E-06 mr1682_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612179300 3.74E-06 3.74E-06 mr1697_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612179300 NA 1.75E-07 mr1864_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612179300 NA 4.05E-06 mr1970_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251