\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0612112236:

Variant ID: vg0612112236 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 12112236
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATGGAGCAATTACATTGGTGAAGAGTTGCTTTTTAGTCCCGGTTCGTAACCACCCTGTAGTCCCGGTTTTCAAACCGGGACTACCAATCCGGGACTAAAG[A/G]
TCGCTATTTTTAGTCCCGGGTGAAATAACTGGGACTAAAGATCGATCTTTAGTCCCGGTTTGTGATCGATAAGGTAGTCCTAGGGCAGTTCCCATTTTCT

Reverse complement sequence

AGAAAATGGGAACTGCCCTAGGACTACCTTATCGATCACAAACCGGGACTAAAGATCGATCTTTAGTCCCAGTTATTTCACCCGGGACTAAAAATAGCGA[T/C]
CTTTAGTCCCGGATTGGTAGTCCCGGTTTGAAAACCGGGACTACAGGGTGGTTACGAACCGGGACTAAAAAGCAACTCTTCACCAATGTAATTGCTCCAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 34.60% 21.20% 16.14% 27.99% NA
All Indica  2759 4.00% 24.20% 25.95% 45.78% NA
All Japonica  1512 96.40% 1.10% 1.72% 0.79% NA
Aus  269 7.80% 79.60% 1.86% 10.78% NA
Indica I  595 3.20% 13.10% 29.92% 53.78% NA
Indica II  465 2.80% 20.20% 29.89% 47.10% NA
Indica III  913 4.10% 34.00% 20.81% 41.18% NA
Indica Intermediate  786 5.30% 23.80% 26.59% 44.27% NA
Temperate Japonica  767 97.10% 0.40% 1.30% 1.17% NA
Tropical Japonica  504 94.80% 2.20% 2.58% 0.40% NA
Japonica Intermediate  241 97.50% 0.80% 1.24% 0.41% NA
VI/Aromatic  96 7.30% 88.50% 3.12% 1.04% NA
Intermediate  90 44.40% 21.10% 14.44% 20.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0612112236 A -> G LOC_Os06g20940.1 upstream_gene_variant ; 3582.0bp to feature; MODIFIER silent_mutation Average:33.999; most accessible tissue: Zhenshan97 flower, score: 41.495 N N N N
vg0612112236 A -> G LOC_Os06g20950.1 upstream_gene_variant ; 1225.0bp to feature; MODIFIER silent_mutation Average:33.999; most accessible tissue: Zhenshan97 flower, score: 41.495 N N N N
vg0612112236 A -> G LOC_Os06g20960.1 downstream_gene_variant ; 3339.0bp to feature; MODIFIER silent_mutation Average:33.999; most accessible tissue: Zhenshan97 flower, score: 41.495 N N N N
vg0612112236 A -> G LOC_Os06g20950-LOC_Os06g20960 intergenic_region ; MODIFIER silent_mutation Average:33.999; most accessible tissue: Zhenshan97 flower, score: 41.495 N N N N
vg0612112236 A -> DEL N N silent_mutation Average:33.999; most accessible tissue: Zhenshan97 flower, score: 41.495 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0612112236 1.90E-06 NA mr1068 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612112236 1.71E-06 NA mr1112 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612112236 2.77E-06 NA mr1112 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612112236 1.41E-07 NA mr1144 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612112236 2.46E-06 NA mr1144 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612112236 NA 8.62E-19 mr1529 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612112236 NA 1.09E-21 mr1877_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251