Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0612112236:

Variant ID: vg0612112236 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 12112236
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATGGAGCAATTACATTGGTGAAGAGTTGCTTTTTAGTCCCGGTTCGTAACCACCCTGTAGTCCCGGTTTTCAAACCGGGACTACCAATCCGGGACTAAAG[A/G]
TCGCTATTTTTAGTCCCGGGTGAAATAACTGGGACTAAAGATCGATCTTTAGTCCCGGTTTGTGATCGATAAGGTAGTCCTAGGGCAGTTCCCATTTTCT

Reverse complement sequence

AGAAAATGGGAACTGCCCTAGGACTACCTTATCGATCACAAACCGGGACTAAAGATCGATCTTTAGTCCCAGTTATTTCACCCGGGACTAAAAATAGCGA[T/C]
CTTTAGTCCCGGATTGGTAGTCCCGGTTTGAAAACCGGGACTACAGGGTGGTTACGAACCGGGACTAAAAAGCAACTCTTCACCAATGTAATTGCTCCAT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	34.60%	21.20%	16.14%	27.99%	NA
All Indica	2759	4.00%	24.20%	25.95%	45.78%	NA
All Japonica	1512	96.40%	1.10%	1.72%	0.79%	NA
Aus	269	7.80%	79.60%	1.86%	10.78%	NA
Indica I	595	3.20%	13.10%	29.92%	53.78%	NA
Indica II	465	2.80%	20.20%	29.89%	47.10%	NA
Indica III	913	4.10%	34.00%	20.81%	41.18%	NA
Indica Intermediate	786	5.30%	23.80%	26.59%	44.27%	NA
Temperate Japonica	767	97.10%	0.40%	1.30%	1.17%	NA
Tropical Japonica	504	94.80%	2.20%	2.58%	0.40%	NA
Japonica Intermediate	241	97.50%	0.80%	1.24%	0.41%	NA
VI/Aromatic	96	7.30%	88.50%	3.12%	1.04%	NA
Intermediate	90	44.40%	21.10%	14.44%	20.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0612112236	A -> G	LOC_Os06g20940.1	upstream_gene_variant ; 3582.0bp to feature; MODIFIER	silent_mutation	Average:33.999; most accessible tissue: Zhenshan97 flower, score: 41.495	N	N	N	N
vg0612112236	A -> G	LOC_Os06g20950.1	upstream_gene_variant ; 1225.0bp to feature; MODIFIER	silent_mutation	Average:33.999; most accessible tissue: Zhenshan97 flower, score: 41.495	N	N	N	N
vg0612112236	A -> G	LOC_Os06g20960.1	downstream_gene_variant ; 3339.0bp to feature; MODIFIER	silent_mutation	Average:33.999; most accessible tissue: Zhenshan97 flower, score: 41.495	N	N	N	N
vg0612112236	A -> G	LOC_Os06g20950-LOC_Os06g20960	intergenic_region ; MODIFIER	silent_mutation	Average:33.999; most accessible tissue: Zhenshan97 flower, score: 41.495	N	N	N	N
vg0612112236	A -> DEL	N	N	silent_mutation	Average:33.999; most accessible tissue: Zhenshan97 flower, score: 41.495	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0612112236	1.90E-06	NA	mr1068	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612112236	1.71E-06	NA	mr1112	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612112236	2.77E-06	NA	mr1112	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612112236	1.41E-07	NA	mr1144	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612112236	2.46E-06	NA	mr1144	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612112236	NA	8.62E-19	mr1529	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612112236	NA	1.09E-21	mr1877_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251