\
| Variant ID: vg0612112236 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 12112236 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
ATGGAGCAATTACATTGGTGAAGAGTTGCTTTTTAGTCCCGGTTCGTAACCACCCTGTAGTCCCGGTTTTCAAACCGGGACTACCAATCCGGGACTAAAG[A/G]
TCGCTATTTTTAGTCCCGGGTGAAATAACTGGGACTAAAGATCGATCTTTAGTCCCGGTTTGTGATCGATAAGGTAGTCCTAGGGCAGTTCCCATTTTCT
AGAAAATGGGAACTGCCCTAGGACTACCTTATCGATCACAAACCGGGACTAAAGATCGATCTTTAGTCCCAGTTATTTCACCCGGGACTAAAAATAGCGA[T/C]
CTTTAGTCCCGGATTGGTAGTCCCGGTTTGAAAACCGGGACTACAGGGTGGTTACGAACCGGGACTAAAAAGCAACTCTTCACCAATGTAATTGCTCCAT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 34.60% | 21.20% | 16.14% | 27.99% | NA |
| All Indica | 2759 | 4.00% | 24.20% | 25.95% | 45.78% | NA |
| All Japonica | 1512 | 96.40% | 1.10% | 1.72% | 0.79% | NA |
| Aus | 269 | 7.80% | 79.60% | 1.86% | 10.78% | NA |
| Indica I | 595 | 3.20% | 13.10% | 29.92% | 53.78% | NA |
| Indica II | 465 | 2.80% | 20.20% | 29.89% | 47.10% | NA |
| Indica III | 913 | 4.10% | 34.00% | 20.81% | 41.18% | NA |
| Indica Intermediate | 786 | 5.30% | 23.80% | 26.59% | 44.27% | NA |
| Temperate Japonica | 767 | 97.10% | 0.40% | 1.30% | 1.17% | NA |
| Tropical Japonica | 504 | 94.80% | 2.20% | 2.58% | 0.40% | NA |
| Japonica Intermediate | 241 | 97.50% | 0.80% | 1.24% | 0.41% | NA |
| VI/Aromatic | 96 | 7.30% | 88.50% | 3.12% | 1.04% | NA |
| Intermediate | 90 | 44.40% | 21.10% | 14.44% | 20.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0612112236 | A -> G | LOC_Os06g20940.1 | upstream_gene_variant ; 3582.0bp to feature; MODIFIER | silent_mutation | Average:33.999; most accessible tissue: Zhenshan97 flower, score: 41.495 | N | N | N | N |
| vg0612112236 | A -> G | LOC_Os06g20950.1 | upstream_gene_variant ; 1225.0bp to feature; MODIFIER | silent_mutation | Average:33.999; most accessible tissue: Zhenshan97 flower, score: 41.495 | N | N | N | N |
| vg0612112236 | A -> G | LOC_Os06g20960.1 | downstream_gene_variant ; 3339.0bp to feature; MODIFIER | silent_mutation | Average:33.999; most accessible tissue: Zhenshan97 flower, score: 41.495 | N | N | N | N |
| vg0612112236 | A -> G | LOC_Os06g20950-LOC_Os06g20960 | intergenic_region ; MODIFIER | silent_mutation | Average:33.999; most accessible tissue: Zhenshan97 flower, score: 41.495 | N | N | N | N |
| vg0612112236 | A -> DEL | N | N | silent_mutation | Average:33.999; most accessible tissue: Zhenshan97 flower, score: 41.495 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0612112236 | 1.90E-06 | NA | mr1068 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612112236 | 1.71E-06 | NA | mr1112 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612112236 | 2.77E-06 | NA | mr1112 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612112236 | 1.41E-07 | NA | mr1144 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612112236 | 2.46E-06 | NA | mr1144 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612112236 | NA | 8.62E-19 | mr1529 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612112236 | NA | 1.09E-21 | mr1877_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |