\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0612100813:

Variant ID: vg0612100813 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 12100813
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATGTACTGTTTCTTTGGTTTTGTTAGGGTTTTTCCTCATTTTGCGTGCCAGCGTGTAGAATCCGTCGTTTCGGAAGATCGCGGTCGCGAGGAAAAGAGTT[T/C]
AGAAAATCCAAGTGAAGAAGCAAGGCAAGTCACACATTCCCCTTGAGCATGTTGTTCCCAATTTACAAATGTTTTACCGTTTGCAAATAAATATGCATGT

Reverse complement sequence

ACATGCATATTTATTTGCAAACGGTAAAACATTTGTAAATTGGGAACAACATGCTCAAGGGGAATGTGTGACTTGCCTTGCTTCTTCACTTGGATTTTCT[A/G]
AACTCTTTTCCTCGCGACCGCGATCTTCCGAAACGACGGATTCTACACGCTGGCACGCAAAATGAGGAAAAACCCTAACAAAACCAAAGAAACAGTACAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 79.40% 13.50% 5.99% 1.04% NA
All Indica  2759 97.20% 0.30% 1.05% 1.45% NA
All Japonica  1512 42.50% 41.20% 16.07% 0.26% NA
Aus  269 96.70% 0.40% 1.12% 1.86% NA
Indica I  595 96.00% 0.80% 0.34% 2.86% NA
Indica II  465 98.90% 0.20% 0.00% 0.86% NA
Indica III  913 97.40% 0.00% 2.63% 0.00% NA
Indica Intermediate  786 97.10% 0.10% 0.38% 2.42% NA
Temperate Japonica  767 19.30% 69.60% 11.08% 0.00% NA
Tropical Japonica  504 70.80% 3.80% 25.20% 0.20% NA
Japonica Intermediate  241 56.80% 29.00% 12.86% 1.24% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 82.20% 8.90% 8.89% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0612100813 T -> C LOC_Os06g20930.1 upstream_gene_variant ; 418.0bp to feature; MODIFIER silent_mutation Average:16.103; most accessible tissue: Callus, score: 24.525 N N N N
vg0612100813 T -> C LOC_Os06g20930-LOC_Os06g20940 intergenic_region ; MODIFIER silent_mutation Average:16.103; most accessible tissue: Callus, score: 24.525 N N N N
vg0612100813 T -> DEL N N silent_mutation Average:16.103; most accessible tissue: Callus, score: 24.525 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0612100813 NA 2.46E-09 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612100813 NA 1.70E-09 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612100813 8.60E-07 2.92E-15 mr1182 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612100813 NA 3.36E-08 mr1182 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612100813 NA 2.56E-11 mr1282 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612100813 NA 7.44E-06 mr1282 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612100813 NA 1.43E-07 mr1606 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612100813 NA 7.02E-06 mr1606 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612100813 1.40E-06 7.67E-15 mr1650 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612100813 NA 2.88E-07 mr1650 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612100813 NA 2.60E-11 mr1658 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612100813 NA 6.03E-06 mr1658 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612100813 NA 5.04E-13 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612100813 NA 3.41E-10 mr1002_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612100813 NA 9.96E-06 mr1449_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612100813 NA 7.80E-08 mr1578_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251