Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0612078079:

Variant ID: vg0612078079 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 12078079
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.85, T: 0.15, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


GTTGGTAGGACACACGTGGGCTTCTGTATATTTTATTTGAGATAGTAGTATGGATATTTATATATATGTATTTTTATCCTTCGAGAATATCCGCTTGTTG[C/T]
TTACATACCATTAAATAGTTATTAAAAATTTGACAACTAAATTCATATGAAATATATCACTCCACAAAAATACAAAAACCAAATTCGACTTCTATAAGTT

Reverse complement sequence

AACTTATAGAAGTCGAATTTGGTTTTTGTATTTTTGTGGAGTGATATATTTCATATGAATTTAGTTGTCAAATTTTTAATAACTATTTAATGGTATGTAA[G/A]
CAACAAGCGGATATTCTCGAAGGATAAAAATACATATATATAAATATCCATACTACTATCTCAAATAAAATATACAGAAGCCCACGTGTGTCCTACCAAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.80% 15.80% 0.08% 0.25% NA
All Indica  2759 86.20% 13.30% 0.11% 0.40% NA
All Japonica  1512 89.90% 10.00% 0.07% 0.00% NA
Aus  269 18.20% 81.80% 0.00% 0.00% NA
Indica I  595 92.90% 6.90% 0.00% 0.17% NA
Indica II  465 95.30% 4.10% 0.22% 0.43% NA
Indica III  913 78.50% 20.80% 0.11% 0.55% NA
Indica Intermediate  786 84.70% 14.80% 0.13% 0.38% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 72.80% 27.00% 0.20% 0.00% NA
Japonica Intermediate  241 94.20% 5.80% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 90.00% 8.90% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0612078079 C -> T LOC_Os06g20890.1 upstream_gene_variant ; 2332.0bp to feature; MODIFIER silent_mutation Average:65.841; most accessible tissue: Minghui63 young leaf, score: 84.596 N N N N
vg0612078079 C -> T LOC_Os06g20920.1 downstream_gene_variant ; 4370.0bp to feature; MODIFIER silent_mutation Average:65.841; most accessible tissue: Minghui63 young leaf, score: 84.596 N N N N
vg0612078079 C -> T LOC_Os06g20920.2 downstream_gene_variant ; 4368.0bp to feature; MODIFIER silent_mutation Average:65.841; most accessible tissue: Minghui63 young leaf, score: 84.596 N N N N
vg0612078079 C -> T LOC_Os06g20900.1 intron_variant ; MODIFIER silent_mutation Average:65.841; most accessible tissue: Minghui63 young leaf, score: 84.596 N N N N
vg0612078079 C -> DEL N N silent_mutation Average:65.841; most accessible tissue: Minghui63 young leaf, score: 84.596 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0612078079 C T -0.07 -0.03 -0.01 -0.03 -0.03 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0612078079 NA 8.70E-08 mr1078 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612078079 NA 2.94E-07 mr1144 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612078079 NA 1.25E-06 mr1556 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612078079 NA 3.77E-06 mr1633 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612078079 2.46E-09 NA mr1065_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612078079 6.08E-08 6.75E-09 mr1068_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612078079 7.77E-08 1.21E-09 mr1078_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612078079 5.35E-07 NA mr1087_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612078079 2.38E-06 NA mr1090_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612078079 7.71E-09 NA mr1091_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612078079 NA 2.99E-06 mr1094_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612078079 1.37E-06 2.84E-07 mr1096_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612078079 6.08E-08 NA mr1108_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612078079 NA 1.67E-06 mr1110_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612078079 1.23E-08 1.01E-08 mr1111_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612078079 7.69E-07 NA mr1112_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612078079 8.42E-06 2.46E-06 mr1121_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612078079 1.47E-07 3.76E-08 mr1144_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612078079 5.25E-07 7.41E-07 mr1211_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612078079 7.46E-08 NA mr1234_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612078079 NA 6.85E-08 mr1510_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251