Variant ID: vg0612076142 (JBrowse) | Variation Type: SNP |
Chromosome: chr06 | Position: 12076142 |
Reference Allele: C | Alternative Allele: T |
Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 277. )
ACAATTTACTTACAAGTACTGAAACAACGCCCGATTTGTAGGTGCTTCTGCACCCTGTACATGGACATCAAAACCCTTCATTTTATGTATTCGTATCGGA[C/T]
TCATAATGCCCCCTTCTGTGCGGATGTGTATGAATGAAGAAACAAAAATAACAAATTTTATCTACACTGTATGGTTACTATTCACTATCTGATTTTGTTA
TAACAAAATCAGATAGTGAATAGTAACCATACAGTGTAGATAAAATTTGTTATTTTTGTTTCTTCATTCATACACATCCGCACAGAAGGGGGCATTATGA[G/A]
TCCGATACGAATACATAAAATGAAGGGTTTTGATGTCCATGTACAGGGTGCAGAAGCACCTACAAATCGGGCGTTGTTTCAGTACTTGTAAGTAAATTGT
Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 97.80% | 1.60% | 0.53% | 0.00% | NA |
All Indica | 2759 | 99.80% | 0.10% | 0.04% | 0.00% | NA |
All Japonica | 1512 | 93.80% | 4.70% | 1.46% | 0.00% | NA |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 99.80% | 0.00% | 0.17% | 0.00% | NA |
Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 99.00% | 0.00% | 1.04% | 0.00% | NA |
Tropical Japonica | 504 | 84.70% | 13.10% | 2.18% | 0.00% | NA |
Japonica Intermediate | 241 | 96.70% | 2.10% | 1.24% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 95.60% | 2.20% | 2.22% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0612076142 | C -> T | LOC_Os06g20890.1 | upstream_gene_variant ; 395.0bp to feature; MODIFIER | silent_mutation | Average:50.879; most accessible tissue: Zhenshan97 young leaf, score: 72.34 | N | N | N | N |
vg0612076142 | C -> T | LOC_Os06g20900.1 | downstream_gene_variant ; 171.0bp to feature; MODIFIER | silent_mutation | Average:50.879; most accessible tissue: Zhenshan97 young leaf, score: 72.34 | N | N | N | N |
vg0612076142 | C -> T | LOC_Os06g20890-LOC_Os06g20900 | intergenic_region ; MODIFIER | silent_mutation | Average:50.879; most accessible tissue: Zhenshan97 young leaf, score: 72.34 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0612076142 | NA | 8.90E-08 | mr1136 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0612076142 | NA | 2.94E-07 | mr1188 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0612076142 | NA | 7.71E-06 | mr1350 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0612076142 | 1.08E-06 | 3.04E-10 | mr1422 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0612076142 | NA | 1.18E-06 | mr1583 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0612076142 | NA | 3.39E-08 | mr1188_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0612076142 | NA | 5.37E-07 | mr1422_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0612076142 | NA | 5.35E-09 | mr1850_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/