Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0612051676:

Variant ID: vg0612051676 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 12051676
Reference Allele: T	Alternative Allele: G
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.96, G: 0.04, others allele: 0.00, population size: 304. )

Flanking Sequence (100 bp) in Reference Genome:

CCTTTCTTAGCTTCTCCTGTGCCTCTCTTGCGATGGACTTAGACTCATCAGCTTCTTTGGCTGTATCTTCCATAATCTTCTGCAAACCAAGCATTCCATT[T/G]
CGGGATTCTTTCTCCTTGGCCTGAACTGCTTCCAGTTCCCGGAGTGCTAGCTGAATCTCCACCCTTAGAGATGCAGCAGCGATGGATGACGTCGCTTCCA

Reverse complement sequence

TGGAAGCGACGTCATCCATCGCTGCTGCATCTCTAAGGGTGGAGATTCAGCTAGCACTCCGGGAACTGGAAGCAGTTCAGGCCAAGGAGAAAGAATCCCG[A/C]
AATGGAATGCTTGGTTTGCAGAAGATTATGGAAGATACAGCCAAAGAAGCTGATGAGTCTAAGTCCATCGCAAGAGAGGCACAGGAGAAGCTAAGAAAGG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	88.20%	11.30%	0.17%	0.36%	NA
All Indica	2759	81.00%	18.20%	0.29%	0.51%	NA
All Japonica	1512	98.50%	1.50%	0.00%	0.00%	NA
Aus	269	99.60%	0.00%	0.00%	0.37%	NA
Indica I	595	97.30%	2.50%	0.17%	0.00%	NA
Indica II	465	94.60%	4.50%	0.43%	0.43%	NA
Indica III	913	60.40%	38.70%	0.44%	0.55%	NA
Indica Intermediate	786	84.50%	14.50%	0.13%	0.89%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	95.80%	4.20%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	88.90%	8.90%	0.00%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0612051676	T -> G	LOC_Os06g20860.1	synonymous_variant ; p.Arg591Arg; LOW	synonymous_codon	Average:71.979; most accessible tissue: Zhenshan97 young leaf, score: 84.624	N	N	N	N
vg0612051676	T -> DEL	LOC_Os06g20860.1	N	frameshift_variant	Average:71.979; most accessible tissue: Zhenshan97 young leaf, score: 84.624	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0612051676	1.28E-07	7.29E-12	mr1068	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612051676	3.97E-08	9.95E-12	mr1078	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612051676	NA	2.00E-06	mr1090	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612051676	NA	1.76E-10	mr1091	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612051676	5.47E-06	9.03E-09	mr1094	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612051676	NA	3.69E-07	mr1096	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612051676	NA	5.77E-10	mr1108	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612051676	NA	7.46E-09	mr1111	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612051676	NA	1.61E-08	mr1112	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612051676	NA	9.49E-08	mr1121	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612051676	1.20E-07	2.59E-11	mr1144	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612051676	NA	5.91E-07	mr1200	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612051676	NA	1.64E-06	mr1211	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612051676	NA	4.02E-08	mr1237	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612051676	7.10E-06	5.24E-11	mr1065_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612051676	4.34E-07	8.11E-12	mr1068_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612051676	8.47E-08	1.05E-13	mr1078_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612051676	NA	1.69E-07	mr1090_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612051676	NA	1.56E-10	mr1091_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612051676	NA	1.38E-07	mr1094_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612051676	NA	4.41E-08	mr1096_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612051676	NA	5.85E-08	mr1110_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612051676	9.37E-06	2.69E-10	mr1111_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612051676	NA	1.60E-08	mr1112_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612051676	NA	4.16E-08	mr1121_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612051676	NA	5.46E-10	mr1144_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612051676	6.28E-08	1.12E-09	mr1211_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612051676	NA	5.62E-10	mr1526_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251