\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0612050111:

Variant ID: vg0612050111 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 12050111
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.64, A: 0.35, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:


GAGCCGGGCGAAATTGTCATGTTTATGAAGTTATGTTTCGTGGTACATGATGTTTCCCAAATACAATTCAGGTCAATCAAGGATTCTGTTTTCTCCAGGC[G/A]
TTGCTAAAGAAAAACAAATTGCCGCGTGCCTTGCACGATCACTCCAATGGTAGTAGAAACGAAACAAATTATGTTTCTGCTGGTTGCAATGTAGCTCGAG

Reverse complement sequence

CTCGAGCTACATTGCAACCAGCAGAAACATAATTTGTTTCGTTTCTACTACCATTGGAGTGATCGTGCAAGGCACGCGGCAATTTGTTTTTCTTTAGCAA[C/T]
GCCTGGAGAAAACAGAATCCTTGATTGACCTGAATTGTATTTGGGAAACATCATGTACCACGAAACATAACTTCATAAACATGACAATTTCGCCCGGCTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.30% 15.10% 0.19% 0.40% NA
All Indica  2759 77.80% 21.30% 0.29% 0.58% NA
All Japonica  1512 98.00% 1.90% 0.07% 0.00% NA
Aus  269 94.80% 4.80% 0.00% 0.37% NA
Indica I  595 93.30% 6.40% 0.17% 0.17% NA
Indica II  465 93.30% 5.60% 0.00% 1.08% NA
Indica III  913 57.40% 41.70% 0.33% 0.55% NA
Indica Intermediate  786 80.50% 18.30% 0.51% 0.64% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 95.60% 4.40% 0.00% 0.00% NA
Japonica Intermediate  241 97.50% 2.10% 0.41% 0.00% NA
VI/Aromatic  96 33.30% 66.70% 0.00% 0.00% NA
Intermediate  90 76.70% 21.10% 0.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0612050111 G -> A LOC_Os06g20860.1 downstream_gene_variant ; 592.0bp to feature; MODIFIER silent_mutation Average:49.456; most accessible tissue: Zhenshan97 young leaf, score: 61.964 N N N N
vg0612050111 G -> A LOC_Os06g20870.1 downstream_gene_variant ; 4871.0bp to feature; MODIFIER silent_mutation Average:49.456; most accessible tissue: Zhenshan97 young leaf, score: 61.964 N N N N
vg0612050111 G -> A LOC_Os06g20850-LOC_Os06g20860 intergenic_region ; MODIFIER silent_mutation Average:49.456; most accessible tissue: Zhenshan97 young leaf, score: 61.964 N N N N
vg0612050111 G -> DEL N N silent_mutation Average:49.456; most accessible tissue: Zhenshan97 young leaf, score: 61.964 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0612050111 9.52E-06 2.07E-07 mr1078 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612050111 4.42E-07 3.92E-10 mr1091 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612050111 NA 8.32E-07 mr1526 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612050111 1.59E-07 NA mr1065_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612050111 1.91E-10 NA mr1065_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612050111 7.33E-06 NA mr1068_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612050111 3.23E-08 NA mr1068_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612050111 2.60E-06 NA mr1078_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612050111 1.17E-08 2.72E-09 mr1078_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612050111 6.65E-08 NA mr1087_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612050111 6.62E-07 NA mr1090_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612050111 9.56E-08 NA mr1091_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612050111 5.09E-10 3.13E-11 mr1091_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612050111 5.23E-06 NA mr1094_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612050111 9.21E-07 2.22E-06 mr1096_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612050111 3.39E-07 NA mr1108_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612050111 6.55E-06 NA mr1110_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612050111 2.37E-07 1.54E-06 mr1111_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612050111 1.03E-06 NA mr1112_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612050111 5.52E-06 NA mr1121_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612050111 2.64E-06 NA mr1144_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612050111 1.01E-06 NA mr1211_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612050111 2.92E-06 NA mr1234_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612050111 5.36E-07 NA mr1234_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612050111 NA 8.82E-06 mr1380_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612050111 7.43E-07 3.48E-08 mr1526_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612050111 NA 8.73E-06 mr1561_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251