\
| Variant ID: vg0612044015 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 12044015 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 103. )
CTGGCCGCACCCTCTGCGCCGCTGCCTGTCGTCGAGCGCTGCCGCCCGCCATGCCCCTCCGCGCCAGCCGCCGCGCGGCCCTCCGTGCTACCGCCAGCCG[C/T]
GCCTCCCCACATCCACCGCTCGCTCCACTGCTGCTCGAGAGGATAGGATAGAGAGAGGAATGGGAGAGATAGAGAGAGGAAAGGGAGATGATAAGAAAAG
CTTTTCTTATCATCTCCCTTTCCTCTCTCTATCTCTCCCATTCCTCTCTCTATCCTATCCTCTCGAGCAGCAGTGGAGCGAGCGGTGGATGTGGGGAGGC[G/A]
CGGCTGGCGGTAGCACGGAGGGCCGCGCGGCGGCTGGCGCGGAGGGGCATGGCGGGCGGCAGCGCTCGACGACAGGCAGCGGCGCAGAGGGTGCGGCCAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 87.20% | 12.60% | 0.21% | 0.00% | NA |
| All Indica | 2759 | 82.40% | 17.30% | 0.29% | 0.00% | NA |
| All Japonica | 1512 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| Aus | 269 | 95.20% | 4.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.50% | 0.30% | 0.17% | 0.00% | NA |
| Indica II | 465 | 95.90% | 3.70% | 0.43% | 0.00% | NA |
| Indica III | 913 | 60.80% | 38.90% | 0.33% | 0.00% | NA |
| Indica Intermediate | 786 | 86.60% | 13.10% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 96.00% | 4.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 33.30% | 66.70% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 81.10% | 16.70% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0612044015 | C -> T | LOC_Os06g20850-LOC_Os06g20860 | intergenic_region ; MODIFIER | silent_mutation | Average:62.86; most accessible tissue: Zhenshan97 young leaf, score: 76.099 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0612044015 | NA | 2.03E-08 | mr1068 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612044015 | 2.95E-06 | NA | mr1078 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612044015 | 1.30E-07 | 3.11E-10 | mr1078 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612044015 | NA | 6.70E-07 | mr1094 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612044015 | NA | 1.69E-06 | mr1111 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612044015 | NA | 3.56E-06 | mr1121 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612044015 | NA | 1.37E-07 | mr1144 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612044015 | NA | 9.09E-08 | mr1068_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612044015 | 1.86E-06 | 4.44E-10 | mr1078_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612044015 | NA | 2.53E-06 | mr1121_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612044015 | NA | 4.41E-07 | mr1144_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612044015 | NA | 3.23E-06 | mr1211_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |