\
| Variant ID: vg0612022465 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 12022465 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, others allele: 0.00, population size: 107. )
ATTTTTAGCTAAATGGCTAACTAACATGACAGCTTTTAATCTTTTGTCAGCTGATTAAGGCATGTGTAACATGGGAGCGGTTAAGAATACATGTACTGTG[T/C]
GCCACCTTCTTGGTGATGAGACCGGTGGTTGCAATTGCAACAGGAGGTGTTATTAAGGCTGCATTCGATACGATAGGTTGGGAACCCATCCTCTCCACAC
GTGTGGAGAGGATGGGTTCCCAACCTATCGTATCGAATGCAGCCTTAATAACACCTCCTGTTGCAATTGCAACCACCGGTCTCATCACCAAGAAGGTGGC[A/G]
CACAGTACATGTATTCTTAACCGCTCCCATGTTACACATGCCTTAATCAGCTGACAAAAGATTAAAAGCTGTCATGTTAGTTAGCCATTTAGCTAAAAAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 51.50% | 33.60% | 0.53% | 14.41% | NA |
| All Indica | 2759 | 70.40% | 5.70% | 0.80% | 23.05% | NA |
| All Japonica | 1512 | 9.30% | 88.80% | 0.20% | 1.72% | NA |
| Aus | 269 | 89.20% | 10.40% | 0.00% | 0.37% | NA |
| Indica I | 595 | 96.50% | 3.00% | 0.17% | 0.34% | NA |
| Indica II | 465 | 82.40% | 9.00% | 0.43% | 8.17% | NA |
| Indica III | 913 | 45.60% | 2.80% | 1.10% | 50.49% | NA |
| Indica Intermediate | 786 | 72.50% | 9.20% | 1.15% | 17.18% | NA |
| Temperate Japonica | 767 | 2.00% | 97.10% | 0.13% | 0.78% | NA |
| Tropical Japonica | 504 | 20.20% | 75.80% | 0.40% | 3.57% | NA |
| Japonica Intermediate | 241 | 9.50% | 89.60% | 0.00% | 0.83% | NA |
| VI/Aromatic | 96 | 72.90% | 25.00% | 0.00% | 2.08% | NA |
| Intermediate | 90 | 43.30% | 38.90% | 0.00% | 17.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0612022465 | T -> C | LOC_Os06g20830.1 | downstream_gene_variant ; 2883.0bp to feature; MODIFIER | silent_mutation | Average:64.193; most accessible tissue: Callus, score: 84.325 | N | N | N | N |
| vg0612022465 | T -> C | LOC_Os06g20820-LOC_Os06g20830 | intergenic_region ; MODIFIER | silent_mutation | Average:64.193; most accessible tissue: Callus, score: 84.325 | N | N | N | N |
| vg0612022465 | T -> DEL | N | N | silent_mutation | Average:64.193; most accessible tissue: Callus, score: 84.325 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0612022465 | NA | 2.07E-08 | mr1242 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612022465 | 1.58E-07 | NA | mr1065_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612022465 | 1.10E-06 | NA | mr1065_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612022465 | 3.13E-06 | NA | mr1078_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612022465 | 2.94E-06 | NA | mr1087_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612022465 | 4.57E-07 | NA | mr1091_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612022465 | 2.91E-06 | NA | mr1091_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612022465 | 4.62E-06 | NA | mr1108_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612022465 | 5.81E-06 | NA | mr1110_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612022465 | 7.72E-06 | NA | mr1112_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612022465 | NA | 6.35E-13 | mr1216_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612022465 | NA | 4.47E-07 | mr1536_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612022465 | NA | 3.71E-10 | mr1705_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |