\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0611952255:

Variant ID: vg0611952255 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 11952255
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GACTCGAAACCGGCGTGGGTCAGTGGTCGATGGGACACGAAGCCCGGCCACGGCAGCCATCAGGACTCAAAGCCAGTGCAGGGGGTTGTTAGATCTCGAA[A/G]
CCACCGTCGCCGCCCATGGCCGTAGTAGGTTCCCTTCTGATGAGAATCTGAACCTTCCATTTTTTTGTGCTGTAATTCTATGGGATTCTTCGTCCATAGT

Reverse complement sequence

ACTATGGACGAAGAATCCCATAGAATTACAGCACAAAAAAATGGAAGGTTCAGATTCTCATCAGAAGGGAACCTACTACGGCCATGGGCGGCGACGGTGG[T/C]
TTCGAGATCTAACAACCCCCTGCACTGGCTTTGAGTCCTGATGGCTGCCGTGGCCGGGCTTCGTGTCCCATCGACCACTGACCCACGCCGGTTTCGAGTC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.80% 1.10% 2.16% 43.00% NA
All Indica  2759 36.20% 0.40% 2.86% 60.53% NA
All Japonica  1512 90.70% 2.10% 0.46% 6.81% NA
Aus  269 12.30% 0.00% 4.09% 83.64% NA
Indica I  595 34.30% 0.00% 1.01% 64.71% NA
Indica II  465 14.60% 0.00% 1.94% 83.44% NA
Indica III  913 44.40% 1.30% 4.27% 50.05% NA
Indica Intermediate  786 40.80% 0.00% 3.18% 55.98% NA
Temperate Japonica  767 96.90% 0.00% 0.13% 3.00% NA
Tropical Japonica  504 80.20% 6.20% 0.79% 12.90% NA
Japonica Intermediate  241 92.90% 0.00% 0.83% 6.22% NA
VI/Aromatic  96 82.30% 3.10% 5.21% 9.38% NA
Intermediate  90 67.80% 4.40% 0.00% 27.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0611952255 A -> G LOC_Os06g20740.1 downstream_gene_variant ; 3416.0bp to feature; MODIFIER silent_mutation Average:18.896; most accessible tissue: Callus, score: 74.806 N N N N
vg0611952255 A -> G LOC_Os06g20750.1 downstream_gene_variant ; 638.0bp to feature; MODIFIER silent_mutation Average:18.896; most accessible tissue: Callus, score: 74.806 N N N N
vg0611952255 A -> G LOC_Os06g20740-LOC_Os06g20750 intergenic_region ; MODIFIER silent_mutation Average:18.896; most accessible tissue: Callus, score: 74.806 N N N N
vg0611952255 A -> DEL N N silent_mutation Average:18.896; most accessible tissue: Callus, score: 74.806 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0611952255 2.72E-06 NA mr1065 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611952255 3.61E-06 1.11E-13 mr1065 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611952255 1.10E-07 NA mr1067 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611952255 4.56E-07 2.30E-12 mr1067 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611952255 NA 1.64E-08 mr1087 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611952255 NA 2.57E-40 mr1091 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611952255 NA 5.86E-15 mr1091 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611952255 NA 1.77E-10 mr1108 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611952255 9.35E-06 NA mr1110 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611952255 NA 3.69E-11 mr1110 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611952255 NA 7.55E-11 mr1112 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611952255 NA 7.22E-07 mr1197 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611952255 NA 6.00E-15 mr1218 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611952255 NA 3.23E-08 mr1218 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611952255 NA 8.46E-09 mr1221 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611952255 2.44E-06 NA mr1234 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611952255 NA 2.61E-11 mr1234 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611952255 NA 5.96E-17 mr1583 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611952255 NA 7.19E-09 mr1583 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611952255 NA 4.98E-12 mr1065_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611952255 NA 2.87E-12 mr1091_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611952255 NA 1.35E-08 mr1110_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611952255 NA 1.98E-10 mr1112_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611952255 NA 1.01E-09 mr1215_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611952255 NA 7.08E-07 mr1215_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611952255 NA 4.83E-22 mr1218_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611952255 NA 1.28E-10 mr1218_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611952255 NA 1.20E-36 mr1221_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611952255 NA 6.58E-15 mr1221_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611952255 NA 2.67E-08 mr1422_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611952255 NA 1.42E-16 mr1583_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611952255 NA 4.23E-11 mr1583_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611952255 NA 3.16E-15 mr1850_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611952255 NA 2.98E-11 mr1850_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251