Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0611943788:

Variant ID: vg0611943788 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 11943788
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GACATACTGATATTTGGGACAAACCTTGGGGTGATAAATGAGGTTAAATCATTTTTGTCTCAAAATTTTGATATGAAGGATTTGGGAGTAGCTGATGTTA[C/T]
CTTAAACATTAAGCTAATTAGAGGTGAGAATGGGATTACACTCTTGCAATCCCATTATGTCGAGAAGATCTTGAATCGCTTTGGCTACATTGATAGTAAG

Reverse complement sequence

CTTACTATCAATGTAGCCAAAGCGATTCAAGATCTTCTCGACATAATGGGATTGCAAGAGTGTAATCCCATTCTCACCTCTAATTAGCTTAATGTTTAAG[G/A]
TAACATCAGCTACTCCCAAATCCTTCATATCAAAATTTTGAGACAAAAATGATTTAACCTCATTTATCACCCCAAGGTTTGTCCCAAATATCAGTATGTC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	65.80%	31.20%	0.06%	2.86%	NA
All Indica	2759	96.10%	1.90%	0.04%	1.99%	NA
All Japonica	1512	11.10%	88.60%	0.00%	0.33%	NA
Aus	269	86.60%	8.20%	0.00%	5.20%	NA
Indica I	595	94.10%	1.70%	0.17%	4.03%	NA
Indica II	465	97.60%	2.40%	0.00%	0.00%	NA
Indica III	913	98.50%	0.40%	0.00%	1.10%	NA
Indica Intermediate	786	93.90%	3.40%	0.00%	2.67%	NA
Temperate Japonica	767	3.40%	96.60%	0.00%	0.00%	NA
Tropical Japonica	504	24.00%	76.00%	0.00%	0.00%	NA
Japonica Intermediate	241	8.70%	89.20%	0.00%	2.07%	NA
VI/Aromatic	96	13.50%	29.20%	2.08%	55.21%	NA
Intermediate	90	52.20%	38.90%	0.00%	8.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0611943788	C -> T	LOC_Os06g20730.1	missense_variant ; p.Thr320Ile; MODERATE	nonsynonymous_codon ; T320I	Average:32.102; most accessible tissue: Zhenshan97 flag leaf, score: 44.637	possibly damaging	-1.796	TOLERATED	1.00
vg0611943788	C -> DEL	LOC_Os06g20730.1	N	frameshift_variant	Average:32.102; most accessible tissue: Zhenshan97 flag leaf, score: 44.637	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0611943788	NA	4.19E-22	mr1020	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611943788	NA	9.58E-74	mr1033	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611943788	NA	7.44E-11	mr1138	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611943788	NA	6.03E-40	mr1176	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611943788	NA	1.14E-20	mr1477	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611943788	NA	1.29E-19	mr1541	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611943788	NA	4.37E-25	mr1631	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611943788	NA	1.32E-08	mr1637	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611943788	NA	3.97E-13	mr1035_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611943788	NA	1.77E-69	mr1087_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611943788	NA	2.97E-07	mr1212_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611943788	NA	7.38E-12	mr1216_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611943788	NA	2.12E-19	mr1276_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611943788	NA	1.93E-14	mr1333_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611943788	NA	1.58E-07	mr1783_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611943788	NA	1.11E-07	mr1837_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251