Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0611863008:

Variant ID: vg0611863008 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 11863008
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, C: 0.01, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:


GCTAGATCCCTACGGCCGGCCTCTGTAGGTACCGGATAGGGTCGATCCAGGCGTATCTCTAATGTCGACATCTGGCGGCTTGTCTTAGCATATGTTGGCT[T/C]
GTATGTTGATCTTCTGTCTTAATCTATTGATCCGTGTATGTTGATTGTGGGTGCCCCCTCTCCTCCTAGGGGGCCTTGTATTTATACCCATAGGTGTCCC

Reverse complement sequence

GGGACACCTATGGGTATAAATACAAGGCCCCCTAGGAGGAGAGGGGGCACCCACAATCAACATACACGGATCAATAGATTAAGACAGAAGATCAACATAC[A/G]
AGCCAACATATGCTAAGACAAGCCGCCAGATGTCGACATTAGAGATACGCCTGGATCGACCCTATCCGGTACCTACAGAGGCCGGCCGTAGGGATCTAGC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.50% 18.50% 0.02% 0.00% NA
All Indica  2759 69.30% 30.70% 0.04% 0.00% NA
All Japonica  1512 99.50% 0.50% 0.00% 0.00% NA
Aus  269 98.10% 1.90% 0.00% 0.00% NA
Indica I  595 70.80% 29.10% 0.17% 0.00% NA
Indica II  465 92.00% 8.00% 0.00% 0.00% NA
Indica III  913 58.30% 41.70% 0.00% 0.00% NA
Indica Intermediate  786 67.40% 32.60% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.20% 0.80% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 85.60% 14.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0611863008 T -> C LOC_Os06g20610.1 upstream_gene_variant ; 4798.0bp to feature; MODIFIER silent_mutation Average:59.173; most accessible tissue: Zhenshan97 flag leaf, score: 72.387 N N N N
vg0611863008 T -> C LOC_Os06g20600-LOC_Os06g20610 intergenic_region ; MODIFIER silent_mutation Average:59.173; most accessible tissue: Zhenshan97 flag leaf, score: 72.387 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0611863008 4.42E-09 NA mr1065 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611863008 8.72E-08 2.12E-14 mr1065 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611863008 6.43E-06 NA mr1067 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611863008 NA 4.72E-09 mr1068 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611863008 NA 4.65E-08 mr1078 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611863008 1.54E-06 NA mr1087 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611863008 2.06E-06 1.81E-09 mr1087 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611863008 4.70E-11 NA mr1091 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611863008 2.25E-08 9.05E-20 mr1091 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611863008 3.95E-06 NA mr1094 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611863008 NA 1.98E-12 mr1094 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611863008 7.78E-08 NA mr1096 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611863008 1.44E-06 6.53E-14 mr1096 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611863008 6.47E-07 NA mr1108 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611863008 NA 1.55E-09 mr1108 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611863008 4.38E-09 NA mr1110 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611863008 1.11E-06 1.53E-13 mr1110 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611863008 NA 2.31E-06 mr1111 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611863008 4.05E-07 NA mr1112 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611863008 NA 5.40E-12 mr1112 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611863008 3.36E-06 NA mr1121 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611863008 NA 9.52E-10 mr1121 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611863008 NA 5.73E-08 mr1144 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611863008 NA 6.05E-09 mr1218 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611863008 NA 1.51E-06 mr1221 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611863008 1.24E-08 NA mr1234 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611863008 1.83E-06 5.88E-11 mr1234 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611863008 NA 3.17E-08 mr1244 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611863008 NA 2.28E-06 mr1583 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611863008 NA 2.44E-06 mr1627 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611863008 NA 1.26E-09 mr1877 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611863008 NA 1.68E-07 mr1063_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611863008 9.22E-08 NA mr1065_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611863008 1.19E-06 1.31E-13 mr1065_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611863008 NA 4.72E-09 mr1068_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611863008 4.59E-09 NA mr1091_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611863008 1.43E-06 2.63E-17 mr1091_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611863008 NA 1.83E-11 mr1094_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611863008 NA 1.73E-11 mr1096_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611863008 2.98E-07 NA mr1110_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611863008 NA 5.55E-13 mr1110_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611863008 1.58E-07 NA mr1112_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611863008 6.21E-06 1.69E-12 mr1112_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611863008 NA 2.31E-08 mr1121_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611863008 NA 2.28E-06 mr1180_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611863008 NA 2.00E-07 mr1183_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611863008 NA 3.68E-08 mr1215_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611863008 NA 2.21E-13 mr1218_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611863008 8.97E-08 NA mr1221_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611863008 2.97E-07 2.59E-15 mr1221_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611863008 6.43E-07 NA mr1234_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611863008 NA 5.40E-06 mr1260_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611863008 NA 2.41E-09 mr1327_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611863008 NA 2.45E-07 mr1358_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611863008 NA 4.83E-08 mr1422_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611863008 NA 5.69E-06 mr1554_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611863008 NA 7.07E-10 mr1583_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611863008 NA 4.30E-10 mr1739_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611863008 NA 3.60E-06 mr1754_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611863008 NA 3.73E-11 mr1850_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611863008 NA 6.99E-07 mr1877_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611863008 NA 8.78E-07 mr1895_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251