\
| Variant ID: vg0611856752 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 11856752 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 268. )
TTGACCTACGGGTGCGATAGGTGGAGTTGCCTGCACAACTGGTTGAGCATCAGTGATTAAGGTTCGATAGTTTGGAAAAACACCTCCTGGCAAGTAGACC[A/G]
GGCCTGTAGCCTGATGCTCAGCTATCGAGCCATCGTCTATCGTCTTCATCATGTTTGACAGTGTGTTGACTAATATCCCGGATTGATTGATCAAAGCATG
CATGCTTTGATCAATCAATCCGGGATATTAGTCAACACACTGTCAAACATGATGAAGACGATAGACGATGGCTCGATAGCTGAGCATCAGGCTACAGGCC[T/C]
GGTCTACTTGCCAGGAGGTGTTTTTCCAAACTATCGAACCTTAATCACTGATGCTCAACCAGTTGTGCAGGCAACTCCACCTATCGCACCCGTAGGTCAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.50% | 31.70% | 1.16% | 0.59% | NA |
| All Indica | 2759 | 94.20% | 2.90% | 1.99% | 0.91% | NA |
| All Japonica | 1512 | 11.40% | 88.40% | 0.00% | 0.20% | NA |
| Aus | 269 | 92.20% | 7.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 90.60% | 3.90% | 3.87% | 1.68% | NA |
| Indica II | 465 | 96.10% | 3.00% | 0.43% | 0.43% | NA |
| Indica III | 913 | 96.40% | 1.10% | 1.64% | 0.88% | NA |
| Indica Intermediate | 786 | 93.10% | 4.30% | 1.91% | 0.64% | NA |
| Temperate Japonica | 767 | 3.40% | 96.50% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 24.00% | 76.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 10.80% | 88.40% | 0.00% | 0.83% | NA |
| VI/Aromatic | 96 | 70.80% | 29.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 62.20% | 37.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0611856752 | A -> G | LOC_Os06g20600.1 | missense_variant ; p.Leu192Pro; MODERATE | nonsynonymous_codon ; L192P | Average:59.479; most accessible tissue: Minghui63 young leaf, score: 72.408 | probably damaging |
-2.029 |
TOLERATED | 1.00 |
| vg0611856752 | A -> DEL | LOC_Os06g20600.1 | N | frameshift_variant | Average:59.479; most accessible tissue: Minghui63 young leaf, score: 72.408 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0611856752 | NA | 5.61E-23 | mr1020 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611856752 | NA | 2.42E-20 | mr1021 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611856752 | 5.19E-08 | 5.19E-08 | mr1032 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611856752 | 8.91E-07 | 8.91E-07 | mr1165 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611856752 | NA | 1.45E-23 | mr1477 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611856752 | NA | 1.14E-13 | mr1478 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611856752 | 6.44E-09 | 6.44E-09 | mr1478 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611856752 | NA | 6.38E-22 | mr1971 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611856752 | NA | 5.26E-71 | mr1087_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611856752 | NA | 3.64E-19 | mr1165_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611856752 | NA | 3.39E-20 | mr1276_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611856752 | NA | 3.16E-14 | mr1333_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611856752 | NA | 7.34E-32 | mr1477_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611856752 | 8.26E-06 | 8.26E-06 | mr1477_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611856752 | NA | 2.24E-26 | mr1617_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611856752 | NA | 1.51E-18 | mr1637_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611856752 | 1.73E-06 | NA | mr1733_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611856752 | NA | 2.76E-07 | mr1837_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |