Search for Variation information by Variation ID:
Detailed information for vg0611852180:
| Variant ID: vg0611852180 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 11852180 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
Flanking Sequence (100 bp) in Reference Genome:
TTTTCCAACTCGTCCCTTTAATATCGGAGCCGACAGCATGTATCTGACTACATCGGCTTTACATATAACAGTGCACTCATTAGATAATAGATAATGCCTC[C/A]
ACCTCGTACACGAAAAATAAAGGCACAAGCATAACTTCTCCACAGGAGAATACCGAGTCTCAGCATCCAAGAGCCGTCGACTAAGATAGAACACAACTCG
Reverse complement sequence
CGAGTTGTGTTCTATCTTAGTCGACGGCTCTTGGATGCTGAGACTCGGTATTCTCCTGTGGAGAAGTTATGCTTGTGCCTTTATTTTTCGTGTACGAGGT[G/T]
GAGGCATTATCTATTATCTAATGAGTGCACTGTTATATGTAAAGCCGATGTAGTCAGATACATGCTGTCGGCTCCGATATTAAAGGGACGAGTTGGAAAA
Allele Frequencies:
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 67.60% | 31.90% | 0.13% | 0.32% | NA |
| All Indica | 2759 | 96.10% | 3.80% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 11.40% | 87.40% | 0.20% | 0.99% | NA |
| Aus | 269 | 91.80% | 8.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 93.30% | 6.40% | 0.34% | 0.00% | NA |
| Indica II | 465 | 95.30% | 4.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 95.20% | 4.70% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 3.40% | 94.80% | 0.39% | 1.43% | NA |
| Tropical Japonica | 504 | 24.00% | 75.80% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 10.80% | 88.00% | 0.00% | 1.24% | NA |
| VI/Aromatic | 96 | 70.80% | 29.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 63.30% | 36.70% | 0.00% | 0.00% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0611852180 | C -> A | LOC_Os06g20590.1 | missense_variant ; p.Trp1036Leu; MODERATE | nonsynonymous_codon ; W1036L | Average:25.325; most accessible tissue: Callus, score: 32.987 | probably damaging  |
-3.264 |
TOLERATED | 1.00 |
| vg0611852180 | C -> DEL | LOC_Os06g20590.1 | N | frameshift_variant | Average:25.325; most accessible tissue: Callus, score: 32.987 | N | N | N | N |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0611852180 | NA | 2.98E-21 | mr1477 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611852180 | NA | 1.21E-09 | mr1714 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611852180 | NA | 4.39E-70 | mr1087_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611852180 | NA | 1.46E-21 | mr1276_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611852180 | NA | 4.42E-14 | mr1333_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611852180 | NA | 8.16E-30 | mr1477_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |