\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0611846756:

Variant ID: vg0611846756 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 11846756
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GACGCAAAAGCGACTCCCCGGCGATTCCTCTCTCGACAAGATCTCCGCCCGCGGTCATGTCTTCTTCCGCCAGCCCATCGGGTGCGCCAATAGCCGAGTA[T/C]
GCTGAGGTAAGTTCCTATCGGCTAAATCCTTCTTTTCTCAGCAATAGATCGATTTTCTTCCATCTTATGCCGCTTCTCTCTCCTCCATTGCTTCTGGATT

Reverse complement sequence

AATCCAGAAGCAATGGAGGAGAGAGAAGCGGCATAAGATGGAAGAAAATCGATCTATTGCTGAGAAAAGAAGGATTTAGCCGATAGGAACTTACCTCAGC[A/G]
TACTCGGCTATTGGCGCACCCGATGGGCTGGCGGAAGAAGACATGACCGCGGGCGGAGATCTTGTCGAGAGAGGAATCGCCGGGGAGTCGCTTTTGCGTC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 37.20% 0.10% 4.02% 58.63% NA
All Indica  2759 9.30% 0.10% 5.98% 84.60% NA
All Japonica  1512 89.40% 0.10% 0.33% 10.12% NA
Aus  269 9.30% 0.00% 5.95% 84.76% NA
Indica I  595 17.00% 0.00% 4.87% 78.15% NA
Indica II  465 8.00% 0.00% 4.09% 87.96% NA
Indica III  913 4.30% 0.10% 7.89% 87.73% NA
Indica Intermediate  786 10.20% 0.30% 5.73% 83.84% NA
Temperate Japonica  767 96.90% 0.30% 0.26% 2.61% NA
Tropical Japonica  504 77.40% 0.00% 0.60% 22.02% NA
Japonica Intermediate  241 90.90% 0.00% 0.00% 9.13% NA
VI/Aromatic  96 86.50% 0.00% 1.04% 12.50% NA
Intermediate  90 46.70% 1.10% 3.33% 48.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0611846756 T -> C LOC_Os06g20580.1 synonymous_variant ; p.Tyr15Tyr; LOW synonymous_codon Average:13.766; most accessible tissue: Callus, score: 55.239 N N N N
vg0611846756 T -> DEL LOC_Os06g20580.1 N frameshift_variant Average:13.766; most accessible tissue: Callus, score: 55.239 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0611846756 1.81E-07 1.81E-07 mr1032 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611846756 1.60E-06 1.60E-06 mr1165 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611846756 NA 1.66E-20 mr1477 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611846756 1.47E-08 1.47E-08 mr1478 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611846756 2.31E-06 3.32E-08 mr1971 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611846756 9.63E-07 8.06E-09 mr1165_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611846756 NA 4.44E-07 mr1212_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611846756 4.51E-07 4.51E-07 mr1477_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251