\
| Variant ID: vg0611846756 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 11846756 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
GACGCAAAAGCGACTCCCCGGCGATTCCTCTCTCGACAAGATCTCCGCCCGCGGTCATGTCTTCTTCCGCCAGCCCATCGGGTGCGCCAATAGCCGAGTA[T/C]
GCTGAGGTAAGTTCCTATCGGCTAAATCCTTCTTTTCTCAGCAATAGATCGATTTTCTTCCATCTTATGCCGCTTCTCTCTCCTCCATTGCTTCTGGATT
AATCCAGAAGCAATGGAGGAGAGAGAAGCGGCATAAGATGGAAGAAAATCGATCTATTGCTGAGAAAAGAAGGATTTAGCCGATAGGAACTTACCTCAGC[A/G]
TACTCGGCTATTGGCGCACCCGATGGGCTGGCGGAAGAAGACATGACCGCGGGCGGAGATCTTGTCGAGAGAGGAATCGCCGGGGAGTCGCTTTTGCGTC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 37.20% | 0.10% | 4.02% | 58.63% | NA |
| All Indica | 2759 | 9.30% | 0.10% | 5.98% | 84.60% | NA |
| All Japonica | 1512 | 89.40% | 0.10% | 0.33% | 10.12% | NA |
| Aus | 269 | 9.30% | 0.00% | 5.95% | 84.76% | NA |
| Indica I | 595 | 17.00% | 0.00% | 4.87% | 78.15% | NA |
| Indica II | 465 | 8.00% | 0.00% | 4.09% | 87.96% | NA |
| Indica III | 913 | 4.30% | 0.10% | 7.89% | 87.73% | NA |
| Indica Intermediate | 786 | 10.20% | 0.30% | 5.73% | 83.84% | NA |
| Temperate Japonica | 767 | 96.90% | 0.30% | 0.26% | 2.61% | NA |
| Tropical Japonica | 504 | 77.40% | 0.00% | 0.60% | 22.02% | NA |
| Japonica Intermediate | 241 | 90.90% | 0.00% | 0.00% | 9.13% | NA |
| VI/Aromatic | 96 | 86.50% | 0.00% | 1.04% | 12.50% | NA |
| Intermediate | 90 | 46.70% | 1.10% | 3.33% | 48.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0611846756 | T -> C | LOC_Os06g20580.1 | synonymous_variant ; p.Tyr15Tyr; LOW | synonymous_codon | Average:13.766; most accessible tissue: Callus, score: 55.239 | N | N | N | N |
| vg0611846756 | T -> DEL | LOC_Os06g20580.1 | N | frameshift_variant | Average:13.766; most accessible tissue: Callus, score: 55.239 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0611846756 | 1.81E-07 | 1.81E-07 | mr1032 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611846756 | 1.60E-06 | 1.60E-06 | mr1165 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611846756 | NA | 1.66E-20 | mr1477 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611846756 | 1.47E-08 | 1.47E-08 | mr1478 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611846756 | 2.31E-06 | 3.32E-08 | mr1971 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611846756 | 9.63E-07 | 8.06E-09 | mr1165_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611846756 | NA | 4.44E-07 | mr1212_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0611846756 | 4.51E-07 | 4.51E-07 | mr1477_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |