\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0611805178:

Variant ID: vg0611805178 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 11805178
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 77. )

Flanking Sequence (100 bp) in Reference Genome:


TCGGCTAGGCGGCGGCTAGGCGGAAACACGCAGCTAGGGTTAGGGTGACGGCACAGCCGGTAGCGACCATGCACGGCTAGAGCAGCAGGGCTACGACACA[G/A]
CGACGACGACACACACGTGGCTTACATAAACATCTTCCCTAGGAATCGGAGAGGAGGCCTCACCGGGAAACGGTAGTGAACGGAGAGGAAGAGGCGATGG

Reverse complement sequence

CCATCGCCTCTTCCTCTCCGTTCACTACCGTTTCCCGGTGAGGCCTCCTCTCCGATTCCTAGGGAAGATGTTTATGTAAGCCACGTGTGTGTCGTCGTCG[C/T]
TGTGTCGTAGCCCTGCTGCTCTAGCCGTGCATGGTCGCTACCGGCTGTGCCGTCACCCTAACCCTAGCTGCGTGTTTCCGCCTAGCCGCCGCCTAGCCGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 44.10% 7.60% 2.09% 46.13% NA
All Indica  2759 12.80% 12.50% 3.12% 71.62% NA
All Japonica  1512 91.60% 0.20% 0.33% 7.87% NA
Aus  269 90.70% 0.70% 1.86% 6.69% NA
Indica I  595 9.20% 18.20% 3.53% 69.08% NA
Indica II  465 14.40% 6.20% 3.44% 75.91% NA
Indica III  913 10.40% 10.10% 2.63% 76.89% NA
Indica Intermediate  786 17.30% 14.60% 3.18% 64.89% NA
Temperate Japonica  767 96.90% 0.00% 0.00% 3.13% NA
Tropical Japonica  504 83.10% 0.60% 0.79% 15.48% NA
Japonica Intermediate  241 92.50% 0.00% 0.41% 7.05% NA
VI/Aromatic  96 58.30% 2.10% 2.08% 37.50% NA
Intermediate  90 53.30% 11.10% 1.11% 34.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0611805178 G -> A LOC_Os06g20530-LOC_Os06g20550 intergenic_region ; MODIFIER silent_mutation Average:14.501; most accessible tissue: Callus, score: 55.23 N N N N
vg0611805178 G -> DEL N N silent_mutation Average:14.501; most accessible tissue: Callus, score: 55.23 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0611805178 NA 4.39E-08 mr1231 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611805178 NA 5.96E-08 mr1557 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611805178 NA 6.00E-07 mr1717 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611805178 NA 1.02E-06 mr1208_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611805178 NA 3.16E-07 mr1232_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611805178 NA 5.88E-06 mr1233_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611805178 NA 2.11E-06 mr1358_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611805178 NA 7.20E-06 mr1415_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611805178 NA 6.66E-06 mr1566_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251