\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0611779998:

Variant ID: vg0611779998 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 11779998
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.58, T: 0.42, others allele: 0.00, population size: 65. )

Flanking Sequence (100 bp) in Reference Genome:


ATGATTAACATCTTTTTTACGGCATGACAAAGATGATAGATTTGCTGCACGTTAACTCTCTCGTGGTTCTTACTACCCATGCCTCCATAGCTACTTATGG[T/C]
CTGCCATACACACCCTCTGCAATACCACTGGCGATGTATGAGCCACTCACGTGGGACCAGACCCGCTTGTCAGTGACTTCTAGTTCTAGCCGCAGTGCAA

Reverse complement sequence

TTGCACTGCGGCTAGAACTAGAAGTCACTGACAAGCGGGTCTGGTCCCACGTGAGTGGCTCATACATCGCCAGTGGTATTGCAGAGGGTGTGTATGGCAG[A/G]
CCATAAGTAGCTATGGAGGCATGGGTAGTAAGAACCACGAGAGAGTTAACGTGCAGCAAATCTATCATCTTTGTCATGCCGTAAAAAAGATGTTAATCAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 46.30% 19.10% 5.35% 29.24% NA
All Indica  2759 21.90% 30.70% 6.74% 40.74% NA
All Japonica  1512 97.60% 0.60% 0.53% 1.26% NA
Aus  269 9.30% 13.80% 7.81% 69.14% NA
Indica I  595 3.00% 10.90% 5.38% 80.67% NA
Indica II  465 14.00% 31.40% 5.81% 48.82% NA
Indica III  913 37.20% 41.10% 6.35% 15.33% NA
Indica Intermediate  786 22.90% 33.10% 8.78% 35.24% NA
Temperate Japonica  767 98.80% 0.00% 0.00% 1.17% NA
Tropical Japonica  504 96.40% 1.00% 1.39% 1.19% NA
Japonica Intermediate  241 96.30% 1.70% 0.41% 1.66% NA
VI/Aromatic  96 32.30% 5.20% 34.38% 28.12% NA
Intermediate  90 56.70% 8.90% 5.56% 28.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0611779998 T -> C LOC_Os06g20490.1 downstream_gene_variant ; 2223.0bp to feature; MODIFIER silent_mutation Average:10.925; most accessible tissue: Callus, score: 28.993 N N N N
vg0611779998 T -> C LOC_Os06g20500.1 downstream_gene_variant ; 2150.0bp to feature; MODIFIER silent_mutation Average:10.925; most accessible tissue: Callus, score: 28.993 N N N N
vg0611779998 T -> C LOC_Os06g20490-LOC_Os06g20500 intergenic_region ; MODIFIER silent_mutation Average:10.925; most accessible tissue: Callus, score: 28.993 N N N N
vg0611779998 T -> DEL N N silent_mutation Average:10.925; most accessible tissue: Callus, score: 28.993 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0611779998 NA 1.81E-29 mr1072 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611779998 NA 1.35E-06 mr1072 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611779998 NA 6.75E-31 mr1075 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611779998 NA 5.50E-06 mr1075 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611779998 NA 1.51E-06 mr1124 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611779998 NA 7.40E-13 mr1149 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611779998 NA 5.04E-29 mr1202 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611779998 NA 9.70E-19 mr1242 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611779998 NA 1.85E-07 mr1242 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611779998 NA 3.27E-09 mr1342 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611779998 NA 8.52E-36 mr1402 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611779998 NA 5.53E-06 mr1795 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611779998 NA 2.56E-07 mr1861 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611779998 NA 6.31E-08 mr1203_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611779998 NA 4.82E-11 mr1216_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611779998 NA 7.51E-09 mr1222_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611779998 NA 1.22E-25 mr1242_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611779998 NA 1.64E-06 mr1242_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611779998 NA 8.19E-15 mr1333_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611779998 NA 3.02E-15 mr1686_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611779998 NA 2.73E-08 mr1795_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251